Report for Sequence Feature Glyma16g06333
Feature Type: gene_model
Chromosome: Gm16
Start: 5737325
stop: 5742143
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma16g06333
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G25220 AT
Annotation by Michelle Graham. TAIR10: anthranilate synthase beta subunit 1 | chr1:8837430-8839478 REVERSE LENGTH=276
SoyBase E_val: 2.00E-137 ISS
GO:0000162 GO-bp
Annotation by Michelle Graham. GO Biological Process: tryptophan biosynthetic process
SoyBase N/A ISS
GO:0008152 GO-bp
Annotation by Michelle Graham. GO Biological Process: metabolic process
SoyBase N/A ISS
GO:0009617 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to bacterium
SoyBase N/A ISS
GO:0009651 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to salt stress
SoyBase N/A ISS
GO:0009723 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus
SoyBase N/A ISS
GO:0009851 GO-bp
Annotation by Michelle Graham. GO Biological Process: auxin biosynthetic process
SoyBase N/A ISS
GO:0010311 GO-bp
Annotation by Michelle Graham. GO Biological Process: lateral root formation
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0004049 GO-mf
Annotation by Michelle Graham. GO Molecular Function: anthranilate synthase activity
SoyBase N/A ISS
KOG0026
KOG
Anthranilate synthase, beta chain
JGI ISS
PTHR11922 Panther
GMP SYNTHASE-RELATED
JGI ISS
PTHR11922:SF7 Panther
SUBFAMILY NOT NAMED
JGI ISS
PF00117 PFAM
Glutamine amidotransferase class-I
JGI ISS
UniRef100_B9HJK0 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Anthranilate synthase, beta subunit, ASB2 (Fragment) n=1 Tax=Populus trichocarpa RepID=B9HJK0_POPTR
SoyBase E_val: 2.00E-136 ISS
UniRef100_UPI00018CC812 UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI00018CC812 related cluster n=1 Tax=unknown RepID=UPI00018CC812
SoyBase E_val: 0 ISS
Expression Patterns of Glyma16g06333
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Gene model name correspondences to Glyma16g06333 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.16g058800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma16g06333
Coding sequences of Glyma16g06333
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma16g06333.1 sequence type=CDS gene model=Glyma16g06333 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCTGCCACATTCTTCTCTCACTTGTCGCTTCTTCAATCCAACAACAACCCTTCTCTCTCTCACACACCCTCTCGCTTCCCTCATTCTCTCACCAACCGTGTCAAACCCTCCCTCGGTGTGGTATCTGTGGCCAAAAGGGTAAGTGGAGTGGTGCCAAAGGCCAATTTGAATGCCTTGGAGGCCAATTCGGGTTTCCCCATTTCGGCTAAGAAGTCCAACAACAACCCCATTGTTGTTATTGACAACTATGACAGTTTCACCTATAATCTTTGCCAGTATATGGGGGAGTTAGGGTTTCACTTTGAGGTCTACCGCAATGATGAGTTGACAGTGGAGGAGTTAAGAAGGAAAAATCCCAGAGGAGTGCTGATATCACCTGGGCCAGGAGAACCTCAAGATTCAGGCATATCTTTGCAAACGGTTTTGGAACTTGGACCAACTGTGCCATTGTTTGGTGTGTGCATGGGTTTGCAATGCATTGGAGAGGCTTTTGGAGGGAAGATTGTTCGTTCTCCTCATGGTGTTATGCATGGAAAAAGCTCTATGGTTTACTATGATGAGAAAGGAGAAGATGGATTACTTGCTGGACTATCAAATCCTTTCTTGGCTGGTAGATATCACAGCCTTGTAATTGAAAAAGAGAGCTTTCCTCATGATGAACTTGAGGCAACAGCATGGACAGAAGATGGTCTTATAATGGCTGCTCGTCATAAGAAATATAAGCATCTACAGGGTGTTCAGTTTCATCCAGAGAGCATCATAACCCCAGAAGGCAAGACAATTGTCCGTAATTTTGTCAAGCTTATCGAGAAAAGGGAGGCTGGTGGCTCTTGA
Predicted protein sequences of Glyma16g06333
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma16g06333.1 sequence type=predicted peptide gene model=Glyma16g06333 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MAATFFSHLSLLQSNNNPSLSHTPSRFPHSLTNRVKPSLGVVSVAKRVSGVVPKANLNALEANSGFPISAKKSNNNPIVVIDNYDSFTYNLCQYMGELGFHFEVYRNDELTVEELRRKNPRGVLISPGPGEPQDSGISLQTVLELGPTVPLFGVCMGLQCIGEAFGGKIVRSPHGVMHGKSSMVYYDEKGEDGLLAGLSNPFLAGRYHSLVIEKESFPHDELEATAWTEDGLIMAARHKKYKHLQGVQFHPESIITPEGKTIVRNFVKLIEKREAGGS*