SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   DTA_uuu_Gm9-5
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   II
Subclass   I
Order   TIR
Super Family   hAT
Family   Ukn
Description  
Chromosome   Gm09
Start Position   40246945
End Position   40249499
Sequence   CATAGGCGGTTTCAAGGCCCGGCTACCCTGGGCAATTGCCCAGGCTCTGGCATAACCCTTTTAATTTTATGTTACTAATA
TTTTTCTTTTTTTTTTTGGTGCTGTATTATTATTTTTCTTTATTAATGAATTAAACGGGCAACTATCATGTTTAGCACGC
AGATTCAACAAAAAGTATCTTGATATTAAATAGTTAGTTGAACTAGCTGGCATAACCCTTTTTGTGGACTGTGTATTCTT
ATCCTTCACTCTTTTTTTTTTTTTTGGTAGAATTTTCCTTCTTATTTATTTACCCTTTGTAAACAATAATTACGATAATT
CATGCAATAGGGTAATAACAACTATAGAAACACCAATCACATGAATTCATTATTATTGGTCAGCTTTTTCACAAATTTAC
TATGAGCTTAAAGCAAATATCATGTGATGTTGTTCTATAAATCTAAGTTGTACATTTATCAATTACTAGTATTTTAGTGA
ATGTTTATTTTATATAACTAAAATTTATAATTTATAATAAATAAATACTTATATATAAATTATGAAATAATTTTACACAA
ACATAAAAATGGAGAAAATTAAAAGAAAAATATTAAAGAAAGGGCAAGAAATTGAAAGGGCAAAACAATTGTAAGAGTTA
AAAATTAAAAGGGCAAAAATATAGGTAACACCTACTGGTTCTTTTCCGACTACCGCCTTCCCCTTTTTTTCGGTTAGTAA
TTGTTTAATTTCAACTGATTGTGGTTTTAAATTGAAACAATTAACACAAAGGTAGCAAAGAAGAAGAAGAAGAAAAATTT
TGGATTTATTTGCACCGCCTAGTAGTAGCAGACACAGAGAAGAAGAAAAATTTGGGTTTGTCTTTGAAAGGTTAAATATT
TTATGTTATATAGAAGTACTAACATTGTGAAAATGGGTCCCATATTTTTCAAGTTTATCTAAAATCTCATATGGTGAAAT
TATAATATTGTATCATACTGATAACTTCAATAAATTTCATTATAAAAAATATTTACTTTATAATATATTTTGTCATTTTG
TGTGCTGCCAAGTGTCAGATTAAGCTACTACACAGCAAGATTCATTGGTTATAAAAGTTTTATTGATAAGTCAAACTAAA
GTGTGTATCTAGTAATATTATAAGCATATAGTATTATTTATAATAGCAGTAAAAAGATCTTTTATAGTGGAATCATACCA
CTTGTAAATTTGTTTATTGATAGATAAATTATCTACAATAAAGGTTTCTTTTGGTTATCTAATTTTATTAGTTTCTATAA
TGGTGTTTAATTGAATATAATATAATGCTTGTTCCTACTCTTTATAAATCATAAGAGATTACTTTTATTTTGAAAAACTA
TTCTTATTTAAATTTTGATTCTTATGATTTTAATTGTTAATTGAGTATTAACTTAAGATCATTTAATTTCAGAGATGAGG
AGATTTTTGGTTGATAGAGCAAGTATTGAGAATGTGAATGTTGTACAACAAGAAGCCGAATTAGAACCGCCACCTAATGT
GGTTAATGAGTTTAACCCAAATGAGATTGTGCGTGATCCAGGTCATAGGAAACAAACGAGCTTTCAAATATATTGCAAAG
AAAAGATCTTAATATTGTGAATGCCATGGAATTAGTTGATGTTGTCAAAGCTCGGTTGGGCACAATGAGAGAGAGTGGCT
GGAATAATTTTTTTGCCGATGTCCAAGGATTTTGTGTTGCTAAAAGTATTCTGGTACCAAATATGGATGACGAAATACCA
GTTCGGGGTCGTTCAAGAGCAGAAGGGAGGACTATCACTAATCTTCATCATTACCGTGCAGAGATTTTTTATGTTGCTAT
TGATAAAATATGTGTGGAGATGGATCACCGCTTTAGTGAAGGAAGTAACATTATACTTGATTGCTTCTCATGTCTTGACC
CCAAGAACTCTTTCTCCAAGTTTGATGTTGATAAGCTTGCTCGTCTTGCTGATATTTATCATGCAGACTTTTCTGATGAT
GACCGAGGAACAATTAGGGATCAACTTGAAACTTATGTGCTTCAAGTGAGAAGAAATGCTTCTTTTTCCACTTGTGAAGA
TGTTCAAAGTTTGGCTATGAAGATGGTTCAAACTGAGAAACATTTGGTATTTCCATTGGTTTATAAACTTATTGAGCTAG
CTTTGATATTGCCGGTGTCGACAGCATCCGTTGAAAGAGCTTTTTCAGCAATGAAGATTATCAAGTCTAAATTGCGCAAT
AAGATCAACGATGTGTGGTTCAATGACTTGATGGTATGTTACACCGAGCGGGAGATATTCAAGTCACTTGATGATATTGA
TATTATTCGAACATTTACCGCAAAGAAGTCTCGGAAAGGACACTTGCCTCGTAATTTTATTTAACCCGCTATTGTAAGAT
TATGTTTATCTCTTTTATTTTAAACTATATTTTTGTTGACAAAATGACGAGTCTCTTTTATTTTGATTGATTACTATTTA
CATATTATATACAATGTGAATTTGCTATCTTTAAATTTTTGTCCAGACTTTATAATTTTTCTGGCTCCGCCACTG





USDA Logo
Iowa State University Logo