SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   DTH_uuu_Scaffold84-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   II
Subclass   I
Order   TIR
Super Family   PIF-Harbinge
Family   Ukn
Description   MITE/tourist
Chromosome   unanchored
Unanchored Scaffold   84
Start Position   63700
End Position   64544
Sequence   GAGTGTGTTTGGATGAGACAATTTAAAATTTTAAAGAATTTTAAATGCTTCAATTTCAAATTTTACTGTCGTCAACGACA
TCAAACCGCCAGAGCGATCGAGCATGTTGGACCCCACGCGGGTCCACCAAGCGGAGATGCAGTCGAGGAGGTTGACGTTG
TTTTCGCAGAGGGTGACGAGGTCGTCGCAGGCGAGGACACAACCTAAGGTTTCAGTGGCGAAGAAGCGGAGGGAGTCGCT
GGGGGAGTCGAAGCAGTCGGAGATTTCCTTGTTGCAGTCGGAGATGAGTTTGGCGAGGCGGTAGGAGGGGATGGCGGTGA
GGATGGAGACGGCGACGACAGTGACATCGGGGTCGGGGAAGTGGAGGTCGGTGCGGATGTCATCACAAACGGACTCCCAG
AGGTCGGGGGTGAGGTGGGTGGAGCAGATGAGGTCGAAGGCAAACTTCTTGCAGACGGCAGAGGCGGGGGCGGCGACGAT
TTCCTCGACGGAAGTCTTGGCGATGTCGCGACCTGTGGCGAACTGTTGGAGGGCTTGGAGGAGGGCGCTAGACTGGCGGA
AGGCGTTGTTGGAGCAAAGGTCGGCTTGGATCTTGGACGAAGAGGATGTCCATTGTGCTGATGGGTTCAGAGTTGAAAGT
GGAAATGCATAAGAGAATTTGAAATTCACTCTCTTAAAGATAGAATTTGAAATTATATTCTTTCAACTAACTAAAATCCC
TTTTAAAATTCTAAAATTTTGAATTCTTTTTACTAAAATATCCAAACAGTTACTTTTAATAAAAAAAATTAATTCCCTAT
AAAAAAATACATTACCTAGTTAAATTATTCTATCCAAACACACTC





USDA Logo
Iowa State University Logo