SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   DTM_uuu_Scaffold92-2
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   II
Subclass   I
Order   TIR
Super Family   Mutator
Family   Ukn
Description  
Chromosome   unanchored
Unanchored Scaffold   92
Start Position   58475
End Position   59113
Sequence   GGTTAAACTACTTATTTGCTTCCTATAGTTTTATCACTCTTATCTTTTTAGTTCTTATAGTTTGAAAGTGATTTTTTAAT
CTCTATCGTTTATATTTTAATTTTCTTTTAGTTCCTACAGTTTAAAAGTGTTTTTTTAGTCCTTATACTTTATATTTTAA
TTCATTTTTAGTTCCTATAATTTGAAAATGATATTTTTAATCCCTATAATTTGTATTTTAATTACTTTTTATCCTTACTA
TAAAAAAATATAAAAATAATTAGCTATAAATTAGTTATAAATTATCAACTATTTTTTATTATAAATTATCTTGCGATAAA
TTAGTTACGAATTACTTGCTAATATTTTTATAGTTAATTGTAATTGATAATATTACTCATATTTTTATGATAAAGACTAA
TAGAGATTAAAAAGACCACATTCAAATTATAGGGACTAAAAGAGAATTAAAATACAAATTATAAGAATTAAAAAAATCAC
TTTCAAACTAATAGACTAAAAAAAAATTAAAATATAAACTATAGGGACTAAAAGAAAATTAAAATGTAAACTATAGAGAC
TAAAAACACCACTTTCAAACTATAGAGACTAAAAGGATAAAAATCATAAAATTATAGGGACCAAATGAGTAATTTAACC





USDA Logo
Iowa State University Logo