SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr83_Scaffold56-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr83
Description   SOLO
Chromosome   unanchored
Unanchored Scaffold   56
Start Position   66848
End Position   67253
Sequence   TGATATGAACGTGGAACACGAAGCCATGCAACAACGACGCTCAAGGAGGGTGAAGTAGCTACCTAAGCACTGGGACGTTT
ACCAGTTAGGATGAACAGGCTTGGGTAAAAGATGATCATATGATCCTTAGGCGGGAAGGGTAGTTAGAAGTGGATTAGTT
AGTTAGGGTTAGTAGCAACTAACCACTTGCGGTTAGATATGGTTCCTTGAGCATATAAATAAGTTGTAACTAACTACGAA
TGGCATAGAAAATAATATCCAGAAGCTTCTTCCTCATTCTCTCAATTTCTTTTTCTTCTCTCAGTTCTCCCGGAACTCGC
ATCCTCCTTTCTCCGTGAGTCTCCATAGATTTTCTCAAGGTCTCACGCATAGTGGAGGTTCCCTAGCCCTCGAAAGCTAG
GTATCA





USDA Logo
Iowa State University Logo