SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr67_Scaffold128-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr67
Description   SOLO
Chromosome   unanchored
Unanchored Scaffold   128
Start Position   2196
End Position   5678
Sequence   TGTCGCGGTGATTTTTGGATGTCAAGCTATTGATTAGCATTGACTCGCAATTTTTAAGATCACCACCGATCTTTTATTTT
TCCGAAGAAAAGGGAGAAAGCTCGAAAAAACCCTAGTTTTTAAGAGATCAAAGGTCCGGGGGTTGGTTACGCAAAGGGAA
GGTACTAGCACCCTAAACGTCTATAGTACTCTATAGGAACCTCTTGCTTATTTTATCTTTATGCTAAATTAATTATTTGT
TTGGAAATAAATGCTCAAGTGTGAAAAAGATTAAAGAGATAGGTTTGAAAGAAAAGAGGAGAAATGTTTTTGTTATTTTT
ATTGATTTGGAAAGACAAAGTCTTTTGCCTACATACCCGAATGGGATCAAAATCATGTAGTTCGGGGTAGAAAGTCGAGT
GGTTGGTTTTGATTGATTTTAAAGTTCGGAAAAAAAGAAGAGTTTAGGCAAGGTAAGAGGCCGAAAAGGCATAGAAGAAA
AAAAGAAGTGAGTTCGATTGATTTTAAATTAGAAAAAATGTTTTGATTGATTAAAGATTGATTAAAGATTTGATTAAGAA
AGAAAGGAAAAGATTGACCCTTTTTTTTGAAATTTTGATTATGGAAAGTTTTTGGGTTTTGACTTTTTTTTTTTTTTTTT
TTTTTTTCTTTTTTTTTTTTTTTAGTTATGTAAAGATAAGTCTAAACGCGCCGGATCCCTTAAAATGACGTTGGATCAAG
TGAGGGTCCTTTTCCTCGGATACGGTTCAAATCACATGATCGTCCTCGGCGGAAAACATAAAAATAAATGTGAGTGTCGG
TGCAGATTCTCATTTTTTATTTTTATTTACATTGGACCTAGATACATTCTAATTGACAAAAATAAATAAAAATTGCAAAT
GCATTAAAATAAATATGCTAGAAGAAATAATAAAATGCATGAAATGCAAAACAATAAATACATATGGTGCATAAAATAAA
TAAAGAAAATAAAATGCAAGACATAAATATAATGCTGGAAATAAATAAAAGAAAATAAAAATGCAAGACATAAAATAAAC
ATGATGCTAAAAAGATAAATAAAAAAAAAATGCAAGACATAAAGATAAATATAATGCTGGAAATAAAATAAAAGAAAATA
AAAATGCAAGACATAAAATAAACATGATGCTAAAAATAAATAAAAAAATGCAAGACATAAAGTAAATATGATGCATAAAA
TAAAAATAAACAAAATAAAAATGCAAGACAAAAAAATAAATATGATACTGGAAAATAAAATGCAAGACGTAAAATAGATA
TGGTGCTGGAAAATAAATAAAGAAAATAAAAAAATGCAAGGGCATAAAGTAAATATGATGCATAAAAAAGTAATAAAAAA
AGAATAGAGAAGAAAAGGGGGTGCAGAAAGTAAAATGCTAGAAGGAACAAAAAAAAGGAAATGGGCTCAAAATAAAAAGT
GGGCTTAACAGATCAAATCTGAATCGTCAGATTGATCGAAGCGTCCAGATTTGATCATGGGGAGACACAGTCTTAGCCAT
TAGATCTTAATCAAACGTCACGAGAGAAGAAGAACAAAGTAAAAACCAAGAGGTGAGACGCATCTGATCAAAACAGGGGA
TAACATTGGCCGTTAGATCTAGGATCTAACGGTTCAACCCTGATGGTCCATGGGGACACAGAGATCCGCGTGCACCATAG
TATTGGTCATGGCAGCAGTATAAATTAGAAAATAAACCCTAAAATAACATAAATCCAACTTCTTCCTCTCTCTAAAGAAA
CGCTCAGAAGCTCTCTTCTCTCTCTAAACACACACCGCCGGAAGCTGTTTACCGGCGCAGTGGCTGGCCGGCCATGGGTG
GCGGCGCCGCCGCGTCGGAAAAAGAAACTCCTCCTTTTTTTAAAAAAACTACATGTTTTGAATTCCTTTTTTCCCTAGTT
CTCAAATCCACCGTTATTTTTTGAAAACCAACACTGATAAAGCCTAGATCTAGCCTTGAATCTTAGAAAAAAGGTGAACT
ACCTTTGTCCTTATGTTATCGTTTAAGCTTCAGAAAACGGTTACAGCTTGGGTTGTGTGGGTGTGGGTGTGGGCTTGGCC
GTTGGTGGTGGTTTTGATGTAGGTTTTAGGCCGCGTGAGTGAGTGGGTTACTGTGTTTGCGTGGGTTTCTGTTCTAACGT
TTCGATTTCTAGGGAAGGAAATGAATAGTATGAGCAAGATGATTTTGGTTTTTTTTTTGTGTTGGTGGTTCACGGAGGGG
GAGGGTGGCGCTGAGTGGTGGCTCTGATGTAGGCTTTAGGCCGCGTGAGTGAGTGGGTTACTGTGTTTGCTGTGTTGGTG
GTTCACGGTGGCTGTGTTGGCTCGGCCGATGGCTGGGCTCGGCCGATGGTGGTTTTCANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTAAAATAAAATAAAATAAAAAAATAAAATAATAATAATAATAAAAAAAAATAAATAAAAAAACGAAAAGAAGATAC
TAATAAAGATATTAATAAAAAAACGGAAATAATAAAAAACACTTAATAAAAGGAAAAGAAAAGAAGAAAATAATAACTAA
AAATAAAAATAATAATAATAAAAAAAGGTAAATAAATAAATAATAATAATAAAAAAATAAAAAAAAAGGGGCGTCTTCAA
AACAAAAATGAGGTATTTTAAAATACCTCCCTGCCGAAATTTCATCTGAAATGATGGAAATTTCCGGCTTAAAAGACGAG
AAAAAAAAAAGAAATAAAAACGGGTCAAAAATGGGGTATGACA





USDA Logo
Iowa State University Logo