SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr53_Scaffold214-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr53
Description   INTACT
Chromosome   unanchored
Unanchored Scaffold   214
Start Position   11077
End Position   16278
Sequence   TGATACGGACAGAGAGAAGGAAGCTACGGGCCAACGTCGTTCAGCTAGGGCAAAGTATTTACCCAAGCATTGGGACGATT
ACCAACTAGAGTAGGAAGGGGCTTTGGGAAGAACGTGGCGGGAAAAGTAGTTACGCATGGTTAGTATGGTAGAGTTTATC
CATGTTAATAACAGCTAACCGTAAGTGGTTAAGCATGAGCCTGGCAATATAAAAAGCTGTAACTAACTAGTAGTGGGAAT
AAGAAACATTCCAGAAGCTTTTCTTTCAAATCCTTTCTTCTCTCTCTCTCTTTGGAACTGCGTTTCTTTTTCTCTCTCTC
GAGCTCTAACTCTCGAGTGGAACGCGCAGTGTGGAGGTTCCCTAGCCCTCGAACGCTAGGTATCATTGGTGCTTTCATTG
AGCACAAGGTGGACGTATGGCGGAGAATACGCGATCAAAAGCTATGTCATCGGAAAAAATGGAGGAGCTGTTCGCGAAGT
TTGCGGCAACGGTAGAAGCAAAAATGGAATCATTAGCGGAGAGGTTAGCACATCTTGAAACCAGTAGATTCAGTCCCTCA
CAAACACAGCCTGAGATGCCTTCATTCCCGGCGGCGGGACCGAGTGCAGCACCGCACCGATTGAAGCTGGATGTGCCGAG
GTTTGACGGCTCCGATGCTACGGGGTGGATCTTTAAAATTACGCAATTTTTCGAATATCATACAACTCCGGATCATGAGA
GGCTTACCATTGCGTCATTTTACATGGAAGGACAAGCCTTGGCTTGGTTCCAATGGATGCACAGAAATGGACAGTTATCG
TCCTGGCCTGCGTTCCTTCACGCCCTTCATTCACGATTTGCTTCAACTTCGTATGAGGATCCAACGGGACTACTATTCAA
GCTACAGCAGAGGACAACAGTAAGCACTTACCTCTCAGACTTTGAAACCCTAGCTAATCGAATTATTGGATTACCTGCTC
CCATGGCTTTAAGCTGCTTTATTTCCGGTTTGTTGCCGTCGATTCGACGAGAAGTCCAAGTCATGCAACCAGCAACCATG
AGCCAAGCAGTGGCTTATGCTAGGTTGCACGAGGAAAAACAAAACGACGTAAGAAGAACGTTCCGGCCTAACCCAGGAGT
TTCGTCCAATTCGCGTCATCAACCAGCACCGACGCCTCCATCTGTGTCTCCATTACTGCCGACACCAACGCGTCCCAATT
CATCCACAGTCCCTTTTAAACGTCTCACACCGGAGGAGTTGGCAATGCGTAGAGAAAAGGGATTATGCTTCCAATGCGAT
GAAAAATACTCACGCGGTCACAAGTGTTCTTCTTCTTTGTTCCTGCTCATCGTGGAAGACAATGATGAAGTACCAGAACC
CCCTGAGCCGCAGTTAACCTTGCCGGACATCGTACCTGAACCACCCCCGGCGCAGTTGAGCTTCAATGCCTTATCAGGAC
ACGTGGTGCCCGAAACATTACGCTTGCAAGGGTATATTCGGGGTCAACCAGTCAGCATTTTGATAGACGGTGGGAGCACA
CATAATTTTGTGCACCACAGGGTCGTTATGTCAGTCGGGTTATCAACGGAGGAAAGCGTACCACTACGGGTCACGGTGGG
CAACGGTGAAGAACTACAATGCCAGCACACATGTTCTAATGTAGAGGTAACCATTCAGCAACATTCATTCTTCATCGATT
TCCATGTTTTATCTATCTGTGGTGCGGATTTAGTTTTGGGAGTCCGATGGCTAAAAACACTGGGACCAGTCTTGACGGAT
TACACTAACCTCACCATGAAATTCATGATCGCCGGCCACCTTGTGGAATTACGTGGTGAACATGAACAGACCCTTGAATC
AATTTCCACGTCACAACTTCGGCGTATGCTCCACACTAATGGCACTAGTATGATGTTCCACATTCAGTTGGAACCTTGTC
AAACCTCACAGCCAGACACTACACCGCTACCTTCCGACATTGAAGAATTAATTAGTAAGTATTCCAAGCTGTTTCAACCA
GTAAAGGGACTGCCACCCTCGAGGGAAACGGACCATGCCATCAACATCATTCCGGGAGCATCTCCAGTCAACGTGAAACC
ATATCGGTATCCACATTATCAGAAAAAGGAAATCGAAGAGCAGATCAGCTTAATGTTGGACAAGGGGTTCATACGAACCA
GCACCAGTTCCTTTTCATCACCGGTGTGTTACTGGTGAAGAAGAAGGACGGATCATGGCGCTTTTGTGTCGACTACAGGG
CTCTTAACGCCATCACGATTCGCGACCGGTTTCCTATACCAACCATTGACGAGTTGCTTGACGAGCTCGGCGAGGCACAG
TGGTTTTCTAAGTTGGATCTAATGCATGGTTACCACCAAATCCTTATGAAGGCTGATGATGTTTACAAAACGGCATTTCG
AACACATCAAGGGCATTACGAATTCCGAGTAATGCCCTTTGGATTGTGTAATGCCCCATCAACCTTTCAAGCAACTATGA
ATCAACTCTTCCGACCGTGTTTACGCAGATTCATCATCGTCTTCTTTGATGATGTGCTGGTTTATAGTAAAACCATGGCT
GACCACGTGAAGCACCTGGAAACCGCATTCAAACTCTTACTTTCAGAGCAGTACTCCTTGAAACAATCCAAATGCGCTTT
TGCTCAGTCCCAATTGGAGTACCTGGGGCATATTGTCTCAGGCAACGGTGTAGAACCAGTCCCGGAAAAGTTGCAGGCGA
TACGGGAATGGCCTTTACCACGATCAGTGAAAGCACTGCGCAGTTTCCTTGGATTAGTCGGGTTTTATCGGAGATTTATT
AAAGGATACGCGAAGATGGCGTCTCCACTTACTCAATTACTCTGTAAGGGTCACTTTCGGTGGTCAGAAGCAGCCACCAT
GGCCTTCAACTCATTAAAAGAGGCAGTTTCCACAGCGCCCGTATTAGCCCTCCCTAACTTTTCCATTCCCTTCGTAGTAG
AGACCGATGCGTCCGGTTCCGGTGTAGGGGCCGTCCTCTCACAAAAAGAACACCCGATAGCATTTTATAGCAAAGAATTT
TGTCCAAAGCTTCGTGCCTCCTCCACTTATATCCGTGAGCTTGCGGCGATAACCATGGCGGTTAAGAAATGGCGCCATTA
CTTGTTAGGTCACCCTTTCGTGATCCTCACTGATCACCAAAGTCTCAGGGACCTTATGACTCAAGCCGTGCAAACGCCGG
AGCAACATCGATACCTCGTCAGATTATTGGGATTCGAATATAGCATTCAGTACCGGCCGGGACGTGAGAACGGCGTCGCA
GACGCCCTATCACGAGTTACGACTGAAGACACCGACGCTTCCATTTATATGCTATCGATACCCCAGTTTGCTTTCCTTGC
TGATCTCAGGAAGGAGCTAAATACTCTTCCTGAAGCAGTGGCTCTACGGGAGAAACTACAAGAGGACCTCACCGGTGCTT
CTGAGTATAAACTCGAGAATGGTCTAATCATCCACAAGCAGCGTCTTTGGCTTCCATCCGGATCCACCATTATTCCACTC
CTTATGGAAGATTTCACAGTACACCCACTGCGGGCCATTATGGGATTCAGAAAACCTTACAAAGGCTTCAGGAGAACTTC
ACGTGGAGTTCCATGCGTAAGGATGTTTGCAAATTTATCGCAGCTTGTGTCACCTGTCAGCTAACGAAATATGATAATCG
CAAACCGGCAGGGCTTCTGTGCCCTCTTCCGGTGCCATATCGGCCATGGGAAGATCTCAGTATGGATTTCATTGTTGGGT
TGCCATCGTATCGGGGTAACACATGCATTCTCGTCGTGGTCGATCGTTTTTCGAAGGGACTCCATTTGGGTATGTTACCC
ACTAAGCATTCTGCAAAACGGGTGGCGGAACTGTTCACCACCATGATCATTCGCTTGCACGGTTTGCCACGAAGCATCAT
CTCCGACAGGGATCCCTTATTTGTTAGCAGATTTTGGCAAGATTTATTTGCTCTCAGTGGCACAAAGCTCCGTCTCAGCT
CCTCCTACCACCCACAGACCGATGGCCAAACGGAGGTTGCCAATCGAATTATAGAGCAGTACCTGCGGGCTTTTGTTCAT
CGGAAACCAGCATCGTGGGGGCAGTTTCTGTTGTGGGCCGAATGGTCCTATAATACCTCGTGTCACTCCGGGACGGGGGT
CACCCCTTTTGAGATCACCTACGGACGAAAGCCACCGGCCATTCCCGAATATGTGGGGAGCACTGCAACTCCGACAGAGG
TTGACGTTATGCTTCGACAACGAGGAGAGGTCCTCCACTTGCTTCGCCGGAAGTTGCTTAAGGCTCAACAAAAGATGAAA
TTCGCCGCCGATGCTCGCCGTAGACCCTTGGAATTCAGTATCGGGGATTGGGTGTTAGTCAAACTGAGACCACACCGGCA
AGTTTCCGCCTCGGAGACCGCGTATTCGAAACTCACGAAGCGCTACTATGGTCCCTTTGAGGTGCAGGAACGATTGGGCA
AGGTTGCGTATCGACTGAGGCTTCCGGCGCGCAGTCGTATTCACCCCGTCTTCCACGTTTCGTTGCTCAAAGCTTTCGTG
GGGGACCCTACCGCAGTGGAGGCTGACCCCCTTCCGATTATGGGAGCCGACGCGGTCACCGACGATCACAAGGAAGCTGC
TCAACCTCCTTTCACGATCCTTGACTCCAGGAACGTGACCACCGAGAGTGGGCTACGCCGTGAAGTACTGGTACAATGGC
GGGGATCCACCCAACAGGACGCATCTTGGGAAGATTGGCACGAGTTTAGCACTCGTTACAACCTCGAGGACGAGGTTGTG
TCTGAAGAGCAGGGGGATGATACGGACAGAGAGAAGGAAGCTACGGGCCAACGTCGTTCAGCTAGGGCAAAGTATTTACC
CAAGCATTGGGACGATTACCAACTAGAGTAGGAAGGGGCTTTGGGAAGAACGTGGCGGGAAAAGTAGTTACGCATGGTTA
GTATGGTAGAGTTTATCCATGTTAATAACAGCTAACCGTAAGTGGTTAAGCATGAGCCTGGCAATATAAAAAGCTGTAAC
TAACTAGTAGTGGGAATAAGAAACATTCCAGAAGCTTTTCTTTCAAATCCTTTCTTCTCTCTCTCTCTTTGGAACTGCGT
TTCTTTTTCTCTCTCTCGAGCTCTAACTCTCGAGTGGAACGCGCAGTGTGGAGGTTCCCTAGCCCTCGAACGCTAGGTAT
CA





USDA Logo
Iowa State University Logo