SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr51_Gm9-2
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr51
Description   SOLO
Chromosome   Gm09
Start Position   38991737
End Position   38994142
Sequence   TGTGACACCCTCTACCCTTACAATTATAACTAACTAATTAAATAAATCATACAAAATTTAATTAAAAGATTATAAACACA
TAATAATAAAAGAAGGAAAAAAAAACATGCAAAATTAATTAATAATTTTTCTTTTTAAACACATTTAATTTAATCAATTC
AAAAGGATAAAGGTTCACATCCACTTAGTGAAAACATAATAGAATATTACTTTTTTTAATAAAAGATAAGATTATCCCGG
CTCAAAACAAGGCCGTCCACTCTAAATAAATAATAAAAAAAATCTAAAGTAGAAAAGTATAACACAATTATATCATTCAG
TAAATCATAATCCCTATCACAGACTAAGTCTCTCCATCTCTAGCATGTGACTCATCATATGAAGGCTCACCTGAAACAAA
GTGGCAATCAGCCCAAACACAAACACACACCGGGAGTGAGTTATCACATTCGTATATAATAAAACATTAGAGCATGTGAA
ACATATAATACTTAAAGCTGAATTTATATAAATAGCATTACTGCACAAAATCGCACACGTTATTCACACCCATTCAAGTT
TACACACTCCATAAAATAACATCAACCACAATTGTTAACTCAATGAAATTCAAACACAAGCGTTATGCAACAATTATACT
AAGACTCAAGCCTATATGCAATGTGGTACCATGTCTGTGAAAAACAACACTGTGGCGCTTAGGAGTACATGACAAAGCAC
ACCACACAATGGGTATACTCGGTCACGCTCACTAAGTAACATCATAAGGTGACCAGTCAGGGTTACTCTGTTTTGCGAGA
ATGCCCCAACCACGTGGGATCAACATGGGCTTAAAGGAGCACTCAAACCGAGTATGTTTACCCCCAAGGCCTAGACTCCG
AAGAATCCGTTTGGGCCTCACCTTCCTGATTCAGGTCCAACCCCTAAAATATTATTTTTTTATTTGCACGCAAACACTGT
TTATGAGTTATATAGTACCCACGAGCTTACTCTTATATTTCAAACATATTTAACAAATTGCGCTATAGTTTAACCCTTCA
GGATCCTAACTAGGAATCCTACAATTTTCTTTAACACTGCGCCTAAAAGTTCTCTCAAGGTACACACTGGTCGGGTTACT
GTATAACTCATAACTTACATGACAAGTAATATCTCTACAAATATCAATCACACACTCATTCACAACCATGTTTCATGTCT
ACAGTTTAACATTTCACACTCTAACTAATTACAAAATATACTCAACAATTAGATAACAATATATCATAATAATAATAACA
TACACTATTTAACTTCAAGGCTTATAAACAAGTAACTATAAAATACACGTAAAATATATATATAAGTATATTATATTCAA
AATATATAACAAAATATATATATTAACGTAAACGTAAACGTACATATCGCATATAACATATAAAAAGTATTAAATACATA
TTAATATAAAGTAATCACAATAATATCAAATATATTATTAAGTAAATACAAATTATATATAACAATAAAATATATACTCA
TATTGATTTCTATGAACAACATGTATACCTATATTTTAAATATATTTCAACTAAGTTGCCAACATAAAAAAAATGCCTAA
TTACAATGTGAATACAACTTTAGTTAATTTCTTTAAATGATTTTAGCCAATTCAATTATCCAACAATCCCTACACCTATG
AATTTCATGACAAGAAATCACCCACGTGAAATAAAATATACAGTTTGTAAAAAACAGTATCAATATATATGTACACGTAT
ACACTGCGGTGTAAAAATAATTATCTGGACACAATATACATTAGCACAGGAACAAGATTGAAAGGCCAACATATCTGGTA
TAAACAAAATCACCACCACACAATTTTTATGTTAATTATAAAGAATTCTAATTCCTAAGGTACACACCTAACAGAGAAAC
ACATCAATCCTACAACAAACTCGCAACAGAACACATCAATTCTACAACAAACTCGCAACAGAACACCAATTGGTTCATCA
AACACACTCAATCCGCGATTAAACATGAAAACATAATTAAATTCATAAACACCCCAAAATAACCCAAAAATTGATCCTCT
AGGGATCCCTACACATGTTCATTCTAATCCCCAAGCGTGAGTAACTCATCCCTTACCTCGAGGTAGTCGCTTAAATGTTC
TCTGTTAGCAATGATGACGTCTCTGGTGCTCTCTAGAGCTCCTCCTCTGATTGCTCTGTTAGGGTTCTTGTGCGTCAGAA
AAGAAGAAAGGAACAGAATGTGTTTTCCAAAAAAGCTGCTCTAGGTTAACATTTGGCTTATATAGTGGAAATTTATGACC
TAATAATTTTTATTTTATTTTTTCTTATTTATTTATGTATTAATTTATTATTTTCTTATTTACTTATTAAAGTTACGGCT
GTTACA





USDA Logo
Iowa State University Logo