SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr488_Gm3-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr488
Description   INTACT
Chromosome   Gm03
Start Position   4203070
End Position   4208053
Sequence   TGTTATGGGTAGGGTAGAGAGAGAGAGACTATGCTAATTACTGGGACTTGTATCAATATTCTCATGCCTTTATTCATGAA
TATAATGCTCCTTTTATACAATGGTGTTACACCGTTATGGCTCGTAACGAACCAAGCTTAACAGAATAACGGTCTAACTA
ACGTAACTAACTGGTCTCTAATGGGTGATACATCATGTACGTGAACCTATATGTAATCCTCGAGATACTTAGGGCGTGAG
GTTTACCTTCTAGAACGTCCCTCGTGGTTCCTTGTTGCAGAACTAATACCAGTCGTAGTGTTGCTAACATCACCTTCCCC
TGGGAAACTCACCTTGTCCTCAAGGTGATGATGACTGCGAATATCCTCCCAGTTTTCCCAAGTTGAGTCCTCGGGTGGTA
AACCCTCCCATTGTATAAGTACTGAGCGAGTAGGGGGAGACGTGGAGGTATCCAGTCGCGAGTTGAGGATAGTAAGTGGC
TTCAAAAGAGGTTGATTGTGGACCGCGTCTGGTGGTAACGGAGACGTTGGGAGTTCAAAAGGGCCGTGGTGCGGTCCTAA
CAACGAGCAGTGAAATATGGGATGTATTCTAGATCCTTGAGGAAGCTGCAGGCGGTAAGCCACTTGTCCAATACGTTCCA
AGATGCAAAATGGTCCAAAATAGCGTTTGGCGAGTTTATTGGGCCTTCCCTGTCGTAACGAAAGTTGACGATAAGGCCGT
AGTTTGACGTAGACTAGCTGTCCTACCTCGTACTGAACGTCTCGTCGTTGCTTATCGGCGAAGTGCTTCATAGTAGCTTG
AGCTTTGATGAGCTTGCGTTGGAGTTTCGCGTGAATCTCAGCCCTTGTTTGGGTGACCATTACTGCTGCGTCGTTATTGG
AAGATCCCAGGACATAGCTAGGAACAGACGGTGGTGGTTTGCCGTAGGTGGCTTCGAACGGCGTAACGTCGGTGCCGGAA
TGTTGTGACGTGTTATAAGACCACTCAGCTAAGGCAAGGAATTTGTACCATTCTGCCAGCTGGTGGTGGACGAAAGAACG
GAGGTACTGCTCCACCGTTCGGTTCATGACTTCCGTTTGTCCGTCCGATTGAGGATGATAGGCCGTGGACATGCGCAGCG
TCGTGCCGTGAAGGCGGAACAATTCTCGCCAAAAGGAGCTGATGAAGACGGGGTCACGGTCAGAAATTATACTACGAGGG
AACCCGTGGAGTTTGCATACCGTATCCATGAAGAGGCTGGCGACCTTGAAGGCCGTGAATTGGGTGGGTAGGGCCCCGAG
ATGAACTCCCTTAGAAAACCGGTCTACCACCACGAGAATTGCCGTGAACCCATGCGAGCTTGGTAAGTGTGTAACGAAGT
CCATGGAGAGGTCTTCCCATACACCATTGGGAATGGGAATAGGTTGGAGTAAGCCAGCGGTTTTTTGTGTGAGGTGCTTG
ACCTGTTGACACACGGTGCAACCCTTGATGAACGCTCAAACGTCCTTCGCCATGGAAGGCCACTGAAAGCTTGATTGCAG
GCGGTGTAGGGTTTTCTTTATTCCAAAATGACCCCCAATTGGTGTTGCATGGAACTCATGTAACAAGGAAGGTATGAAGG
AATTCTTTGAATCTAGCCAGATCACTCCTCAAAAAAGGATGAGGTCGCCGGAGATGGCAAAATCGCGATACTGCTCCAGA
TGGGCAAGTACGGCGGCGCGTTGTTGCTGGAATTCAGGGCTGGCCTTAAACGTCTCCTTTAACTGAGTCATAAACTCATG
GTGAGGTATCGAAAGGATAAGGCATTGAGCCTGGGACAAGCAGTCAATTTGAGAGAGAGAATCTGCGACTATGTTAGAAG
ACCCTGCCTTATATTGTATGTCATAGTCAAAACCCAAAAGCTTGGCTAGGTAGAACTGTTGTTCAGGTGTCTGAACCACC
TGAGACATTAATTCCCTAAGGCTCCTTTGATCTGTGTAGACTGTGAACCGATGGCCCAGCAAGTATTGCCGCCATCGTCG
AACTGCTGCCGTGATTGCGTGCAGTTCCCTAACATAAGCTGAAGCGTGTTGCAGTCTAGGGCAAAGAGGTTTGCTGAAGT
ACGCTATAGGATGGCCTTGTTGTTGGAGAACTGCCCCTATGGCACTGCCAGAAGCGTCTGTTTCGAGCACGAAGGGGAGG
TTGAAGTTAGGGAGGGTGAGGATGGGGGCTGTAGTCATGGCGGTTTTCAGGGAATTGAAGGTAGACTGGGACTCCATGGT
CCATTGAAAGGCGTCTTTACATAGCAATCTGGTCAATGGTGCTGCCAAGCCTGCGTACCCTTTAATAAACTTTCGGTAGA
AGCCTGTGAGGCCCAGGAAGCTTAGAAGATCTTTCGAGGAACGAGGGGTAGGCCAGTCAATGATGGCCTGAACCTTGGAA
GGGTCAGGTTGTACTCCCTTGCCGGAGACGACGTGACCTAAGTAGTCAAGTTGTCGTTGTCCGATAGAGCACTTCGAGCG
CTTGAGATAATATTGGGCCTGTGATAGAGCCCCGAAGATGCATTCCAAGTGAAGAAGATGATCAGGAAGGGTTTCGCTAT
ATATCAATATATCATAAAAAAAAACCGCTACGCATTTCCTCAGGAAGGGGTTGAGTAAAGCATTCATGGCTGCTTGGAAG
GTCGAGGGTGCGTTGCATAACCCGAAAGGCATCACTCTATACTCATAGTGGCCATTGTGGGTTCGAAAGGCGGTTTTAGG
AATGTCACTATCTGCCATTAAAATCTGGTGAAAACCCTCTCGTAAGTCCAGCTTCGAAAACCATGAAGCATGGCCAAGCT
CATCCAAGAGTTCTTCAATGGTGGGTATTGGAAACCGGTCTCTTATTGTGATCGCGTTTAATGCTCTGTAGTCAATGCAC
ATGTGCCATGTGCCGTCCTTCTTTTTCACCAATAACACGGGTGAAGAGAATGGGCTTCTGCTTGGCTGTATTAACCCGGA
CTCGAGTAAGGCAGTGACTTGTTTTTCAATTTCATTTTTCTGAGAGTGGGGGTACCTATAAGGTCTAACATTGACTGGGT
GAGCTGAAGGAATGAGGTTAATGTGATGGTCATGCTGTCTAGGTGGAGGTAAGGTAGAGGGTTGCTGGAAAAGATTTTGA
TATTTGAGGAGAAGGGTGTTAATGGCGGGATTAGGATGAGGTGGGTCACTGTCTGGTTCGGGTTGAATGACGGGTAGCAG
GGATAAGTGAAACAAACCCGAGATGGAGTGGGTATGGATGCTTCGTCGAAGTTGGTGGGCTGATGTCGGGTCAGTGTTGG
AGGAAACGTCTGCATGAAGGGTAATGGGCTGGTCCAAGTAGGTGAATGCCATCGTAAAGGAGGTGTAATCAGTGATAATT
GGGCCCAAGGTCCGTAACCACTCAACCCCTAAAACGACATCGGCGCCACTTAGAGGTAAAACGCGCAGTGTAACCGTGAA
CAGGTGGTTCTGAATAAGCAACGTAGTGGCCGGACATAACTGCCGGCATTCCATTACGGAACCATTGCCGACCATCACCT
TGAGGGCCATCGTCTCTTCCATGTTCAGACCAAGAAATTTTGCGACACGTGGTTGTATAAAATTGTGTGTACTGCCACTA
TCTATTAAGATAGTGACACGTGCGTGGTTGATAACACCATATAAGCGGAAGGTATCGGTGGCCGGGACTCCCGCCATAAC
ATGTAAGCTGATGTGAGGTTGGAGAAGACTGGGGTCGTAGGGTGGGGGTGTTTCTGTTAAAGGTTGAGGAAGGGTTTCGT
GGAGGTTATTATCGGAAGCTGAGGGCGCATCGGAGTCTGCGATGAACAAGAGCACACGCCCTTTACATCGATGGGAGGAG
CTCCATTTTTCGTCACAATTGTAGCATAGGCCTTTTTCGCGCCTATGCATCATATCTTCAGGAGTGCGCTGGATAAAGGG
AGTCTTGGGTCGAGGGTGTTGAGTCAGAGTGGAGGATTGCGGAGTTGAGGTTTGGGGTATCAGTGAGGAGGGCCGTGAGT
TTTTCCGACGATCATTGATCTTGTCTTCTTGAAGACGAGCAAGGGCAGTGGCGTGGGGCAACGAAACCGGCTGGAATGCC
TGTAGTTCCCTCCTGATTTCGGGATTTAAACCTGAAATAAAACAACTTAGCAAATCGGAGAGTGAAAGACCAACGATACG
GTTTGCCAATCTTTCAAATTCGGTCATGTACTCCGTCACTGAACCGCGTTGAACGAGTTTGAATAAAGTGCCACGAGGAT
CATCATAAATGGAGGGGGTGAAACGAGTTTCGATTGCGTGAAGTAAGGCTTGCCAGGTTGTAATGAATCCGTTCCGATAC
ATCCATTGGAACCAACTAAGAGCAGCGCCGTCAAGGTAGAATGACGCGACAGTGATCCGGTCTTCCTCTGGTGTTGCCTG
GTAATCGAAGAACTGGGAGATCTTAAAGATCCATCCCAGTGGGTCATGGTCGTCAAAACGTGGTACGTCAAGCTTGACAG
GAGGGCGCTGATGTATACGAGGGGAAGAGGATGGTTGTTGATATGGCGGTATGGAAGAAAAGCGTTCACACATGGCGTCT
ACTCTAGAGGCTAGCTCGGAGTGTTTTGCGGCGAGGGTGGTGAGGGCCTCCTCGAGGCGGTCGGTGGTGGCGCGGCGAGT
ACCGTGCTCCGCCATAATAGCAGGTCGGACCAAGATCTTATGGGTAGGGTAGAGAGAGAGAGACTATGCTAACTACTGGG
ACTTGTATCAATATTCTCATGCCTTTATTCATGAATATAATGCTCCTTTTATACAAAGGTGTCACACCGTTATGGCTCGT
AACGAACCAAGCTTAACAGAATAACGGTCTAACTAACGTAACTAACTGGTCTCTAATGCGTGATACATCATGTACGTGAA
CCTATATGTAGTCCTCGAGATACTTAGGGCGTGAGGTTTGCCTTCTAGAACGTCCCTCGTAGTTCCTTGTTGCAGAACTA
ATACCAGTCGTAGTGTTGCTAACA





USDA Logo
Iowa State University Logo