SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr478_Gm3-2
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr478
Description   INTACT
Chromosome   Gm03
Start Position   27181811
End Position   27193102
Sequence   TGTTAGGTTGAAGATTATCAACCTATGATTCCTTACTACTCTCAGAACATAGAACCACGACCTCACACAAGAACTCAGAA
TACCGAGGAAGACGGGAAACTCACTCGTGGAACTCACACGAGAAAGAATAGTCCCAAGGGACTGAGTGTTATTAATTTTT
TATGAATTAATCTGATTACAATAGGATACTGCTATTTATACAAATGAAAGCAATGGGACCTGCTTAAATTCTAACCACCC
TTTTTATTTTTCACCCCTTACAGTTATTTTTATAAACTGAGTATTACAATTTCCCCTCCATCTAAAAGCCTTGCCCCCAA
GGCCCTTTCATCCACTAGCCTCGTTAATAAAAAGTCCCAATCCACTTGAGGAAATTGTTGCTTCAGCTTGTGCACCTCAT
GCCATGTAGCTTCTTCTGGTGTGGTATGTTGCCAATGTATTAGCACTTTTGTAACCAGCCTGTTGCCTTTTTTCTTTATT
CTTCTAGCTAAAATGTCAATTGGCTTCAGCTCCAATTGATTATTGCTGTCAAAACTTGGCAGTGTTGTAGAAACTAGACA
ATCTCCATGATGTCTTTTCAGCAAGGAAATATGGAATACATTATGTATGCAAGCTTGAGATGGTAATTCTAGCTTGTATT
CCACCTTCCCCACTCTCTCTACAATTCTGTAAGGACCATAAAATCGTGCAGCTAATTTGTGAAACACTGAGTTAGGTATT
GATTGTTGTTTAAATGGTTGTAACTTCAAATATACCCAATCTCCCACTGCAAATTCTTTGGATGAAAGGCTCAGAATCAA
GAGGTACATTAAAATGATGCATAAATAAAGTGATTAAATGAGGATAAGGCATCAGAGCATTGGATCGCAATGCCTTTTGC
ATGCGATATCTGATAAGATGAGCCCAGTCGATCTGACGACCGGTTAAGAATACCCATATAACTATTAGGTCCTCCTCAAA
GACCTAAGCAAGATTTGATGAACGAGGAAGAAGAATACACACAATTAGATAATGCATGATGCAACATTCGAAAGTCAATG
AATCCGCAGGCAATCTGCCGCTCATTTCCGCCCGATCGGTGCAAACCATTCGGCAGGCATCAAGACTTGAAAAATCAAAT
TTACAGTCATCAACAATGGTGCCCTTAAAAGGTACACCTTAACTGGACAACTGAGTTAACTCAAAAAAGACAGATTCATC
AATTTGCATCCTAATTCCATGAACTTCAGAAATCAAAGTACTACCCTGAATTTGTAAGTTTGAATAAAAGGCACGAACTA
GTTCAGGATAATGGGGAAGTTTTAACGACATGAACTGAATTAATCAGAAGTTTTGAAATGCTTGAAAACAATCAAACACT
TCATCATCAAAGAACTCCAAATCAAGATACTTAGGGTCTAAAATTGAATGAGAAGAGAAATGGGAAGAGTACCATATACG
TTGTTCGTCCGATGAAAACAACGTAGAGGATGGCAAGGAGGAAGAAATTGGTGCTGGCGGTGCTCTAGTGGCTCCGAGAT
GTGGTGTTCCTATTGCCGCAGCGGAGGTGGATGAACCCTTGCGCTTCTTGGATGATTCTTCCATTTGGTGAAGTTATTGA
AGATTTTGATCGATTGGAATGAAAGAGAATTTAAAATGATGAAAAATGGGCTTTTGTGGGAGGTGATTTGGTTGAGAAAT
GAAGGAGATATGGCAAATTGAAGATTGGGGAAGAGAATGCGCTATCGAGGGAAAAAATTGCGAAAATGAAGCTGTTGAAG
ATTCTTATTTATAGGAAGGGACGTTTGGTAATCGATTACAAGGGTTGGTAATCGATTACCAGAACAAACACCCTTCTGGT
AATCGATTACATGGCCAATGTAATCAATTACAGGAAGGTTGTTCTTGTGTAATCGATTACCAGAGTACTATGTCAAGCCT
TTTCTTCTAGAAAGACTTATTTCTATGTCTAGAAACTTCATTAAATTTCAGCAATCAATTAGACAATCAATTATTGACAA
GTAAATCACACAAATCAACCATGAACAATAATAATGCATCAATTAATTTTAATCATCCTAACATATCAAAGAAATTCTAT
CATAACTCAAACAAATAATTCTTAATGACCTACATCATTAATATCTAAAAGACCTAATTCTCTTCTAATGGTAAAGAAGG
TTTCCTTAGGGAGAGGTTTGGTGAAAATATCAGCAAGTTGATTATTAGTATCCACAAATTCTAAAACACAGTCTCCCTTA
AGAACATGGTCTCTTAAAAAGCGGTGCCTTATTTCTATGTGTTTTGTTCTAGAATGGTGTACTGGGTTTTTGAAGAGATT
AATGGCACTAGTATTGTCACACCTTATGGGTATGTGATTAAGAAGAATACCATAGTCAGATAGTTGTTGCTTCATCCATA
ATATTTGTGCACAACAACTACCGACAGAAATATATTCCGCTTCAGTAGTGGATAAAACAACACTATTTTTTTTCTTGCTA
TGCCATGATACAAGAGCAGATCCAATGAATTGGCAAGTCCCACTTGTGCTCTTTCTATCAGTTTTGGATCCGACAAAGTC
GGAATCAGAGTATCCTATTAAGTTACATGTTTAGTTCTTAGGATACCATAATCCTAAATTGATTATTCCTAATAGGTATC
TTATGATCCTTTTTACTGCACTCAAATGTGATTGTTTGGGGTTGGATAGGAACCTAGCACACATGCATACACTAAACATG
ATATCCAGTCTACTAGCAGATAAATAGAGAAGAGATCTGATCATACCTCGATATTTTTTCATGTCTATAGACTGACTGGA
TTCATCTTTATCTAAGTAACAGCTAGTACTCATAGGTGTAGCCATGTGCTTTGCACTTTCCATCCCAAATCTTTTGATTA
GTTCTTTGCAGTATTTTGTTTGGTTGACGAATATACCTTCTTTAGTTTGCTTGATTTGTAACCCCAGGAAGTAAGTTAGT
TCTCCCATCATTGACATCTCAAATTCGCTTTGCGTATCAAGTGAGAAATCCTTGCACAGTGAATCATTAGTGGATCCAAA
GATTATATCATCAACATATATTTGAACCAACAGAATATCATCATGCTTTTTCTTTATGAATGGTGTGGTACCCACTTTTC
CTCTAGAAAAATCTTTCTCTAAAAGAAATTTACTTAGACGTTCATACCATGCCTTAGGGGCTTGTTTCAGACCATATAAA
GTCTTTTTCAATCTATAAACATGATTTGGCTTATCTAACATTACAAAACCTGGGGGTTGTTCAACATATACTTCTTCTTG
AATTAAGCCATTTAGAAAAGCACTTTTAACATCCATTTGATAAAGCTTAAAATTCATTATGGATGCATAAGCTAAAAGCA
TTCTAATGGCTTCTAATCTTACAATAGGAGCATATGTTTCTTCATAATCTATTCCCTCTTCTTGATTATACCCTTTTGCA
ACTAACCTAGCCTTATTCCTAATGATTATGCCATGTTCATCTAACTTATTCCTAAAAACCCATTTTGTTCCTATGATGGG
GTAGTTTTCAGGTTTCTCTACTAGTTCCCACACATTGTTTCTCTCAAATTGATTTAGTTCTTCTTGCATAGCAACTATCC
AATGATAATCTATTATGGCTTCACTTAAATTTTTAGGTTCAATCATGGACACGAAAGCCATATTATTGCATAAATATTTA
AGAGAATGTCTAGTTGTTACCCCTTTTGAGATATCACCAATAATGTTGTCAAGGGGATGATCTCTTGAAGCTTTCTACTC
TCTTGGAAGATCATTATTTGCTTTGACTTCTACTGGAGGATCTTCATTGCTTCCTTCTCCTTTTCCTTTAGAATCTTGTC
CATGAATATGCATTTGTTCTAAAGATTCTGCAATATCATCTAAAATATCCTTTCTTGGAGAAATAGTATTAGACTCATCA
AAGGAAACATGAATAGATTCTTCAATATTCATTGTTCTCTTATTATATATTGTATAAGATTTACTATCAAAGGAATAACC
AAGGAAAATTCCTTCATCTGACTTAGCATCAAACTTTCCTAAGTTTTCTTTTCCATTGTTTAATACAAAACATTTGCAAC
CGAAAACATGAAGATGTGAGATGTTTGGTTTCCTACCATTGAACAGTTCATATGGAGTTTTCTTTAAAATGGGTCTTATT
AAAGCCCTATTCATGATATAGCATGTAGTATTAACGGCTTCGCTTCAGCCCAAAAATATTTTGAAAAAGGAGTGTCATTT
AATAAGGTTCTAGCAATTTCTTCCAAAGACCTAATTTTCCTTTCAACAACTCCATTTTGTTGAGGAGTTCTAGGTGCAGA
AAAGTTATATTCAATGCCATGCTTATCACAAAATAATTCAAATTCTTTGTTTTCAAATTCACCCCCATGATTACTCCTAA
TAGATATAATTTTGATATTTTTCTTGTTTTGAATGATTTTTGCAAGTTTCCTAAATGCTTGAAATGCATCATTCTTATGA
GTGATAAATAGTGTCCAAGTGTATCAAGAATAATCATCAACTATAACAAGGGCATAATAACTTCCTCCAAAACTCATGAT
TCTTGAAGGGCCAAACAAATCCATATGTAGTAATTGTAAAGGTTGAGTAGTTGAAACAATGTTTTTGGATTTGAATGAAA
CTCTAGTTTATTTTCCTTTTTGGCATGCATCACATAGTCTATCTTTTTCAAATTTTAGTTTTAGCAAACCAACAACTAAA
TCTTTTGAAATTAATTTGTTTAAGTGTTCCATGTTAATGTAACCAATCCTTTTATGCCATAGCCATGGATCATCATCTTT
GCTAAGAAAACATTGATTATCACCTAGTTTTTGATTTAAGTCTATCATATAAACATTATTGACTCTAAACCCTATATGCT
TTATATTTGTATCATGTTCATGTTCAATGACACATTTTTGAGAATCAAATGATACCAGATAGCCTTTATCACATAATTGA
CTAACACTAAGCAAGTTGTGCTTAAGGCCTTCAACAAGTAGAACATTTTCAATGGAGGTTGAAGAATTTGTACCTATTTT
TCCAACTCCAAGAATTCTACCTTTGTTGTTGTTGCCATAAGTTACATGCCCGCTTTTCTTGGGAGAGATTTATGTGAACT
TTGATGTGTCCCCCGTCATATGTTTTGAGCACCCGCTATCTATGTACCACTTTTTCCTCAATGGTTCCTACAAGATCAAT
ATTATGACTTAGGTACCCAAACTTTATTGGTTCCTTGAGTGTTAGTGTGAACAAAGGATCCTTTTGGGACCCAAATCATT
TTAATATTGTTGCAATTTTTTCTAAAATAGCATGTAGATGTTCCATGTCCTTTTCTTCCACAGTAAAAACATGTAATGAA
AAGAGAATTATAGTTTTGTGTGGAAGAAAAGAAATTTTTATAAAACTTTTGTTATTTTTCTAGTTTATATCCAATCCCTG
CTTTATCAAAAACACATCTTTGTTTTCCTAATATAATATCTAGGTTGTTTTTACCAATTGAAAATTTTGCAAGTGAGTTT
TTCAGGTTTTTAATTTCTTCTACATATTTACTACAACATTCACATGAATTTTCTTTTTCAATAGTCATAGTAGAAGCATT
TACTTTACTACTTGATTTAGAGATTGAAACTTCAGTCTTAAGATGATCTAACTCTTTGTTTAACTTTGAAATCTCTTTCT
CTAAATCTGAAATGGTTTTCTTAGATGAAGAAACAAGTTTTGCAAGTTTAATAGATTCACTATGTAATTCAGCAAATGCA
TCTTGTAACTCATCAAAAGAAATAGATTTGTTAGAAGATGTTACCTCTTCGTCCCTTTCATAGTTTTTGCCCATTAGACA
TAGATTAATCACTTCTTTTTCAAAATCATCAGATGATTATAAGTTGCTATCATCCCATGTGATGTAGGCCTTTTTTGCCT
TCTTTTCTCCAAAGTTCTTCTTCTCGGACTTCTCCATCCTTTTCTTAAAAGTTGGACAATCAGCCCTTAGATGTCCGGGT
TGATTGCACTCATAACATCTTAAAGTTTGAGATGATTCTTCAGTTCTCCTTTTTGGTTTGAAGTTCTGGCATCTTTGATT
TCCTCTCATTTTAAGAAATTTGTTAAATATTTTGACAAAAAGATTGAGATCTCCATCTTCTTCCAAGTCTTCGTTGTCAC
TTTCTTCTTGAATAGAAGATGAAGCTTTGAGTGCTATTCCCTTCTTCCTTTTGTCATTTTCTTCATGTTGATTTAGTCTT
TGCAACTCCATCTCATATTCCTGAAATTTTCCAAATAGTGTGGCAAGAGACATAGTAGACAAATCTCTAGATTCTGTGAT
GGCTGTTACCTTTGGTTGCCAATCTCTACTTAGACATCTTAACACTTTATTTATGAGATCCTCGTTTGGAAATATTCTTC
CTAATGATGCAAGATAATTAACTATATGTGTGAATCTTTTCTTCATATCATGTATACTTTCATTTGTCTTTATCATATAC
AATTCATACTCATGAGTTAAAGTATTTATCCTAGATCATTTAACATCTGTAGTGCCCTCATGTGTAACTTGTAGAGTTTC
CCACATATCCTTAGCACTCTTACAATTTGAAACCCTAAAATATTCATCCATTCCTAGGGCAGAAGTAATGATGTTTTTAG
CCTTCAAGTTATACTGCACTAATCTTTTTTCTTTCTCAGTCCATTCTTCTCTAGGTTTTTCTATTGTTGCACTTCCAGCC
GTTATAGTGGGTACATAAGGTCCTACTTCTATGGCTTCCCAAATGTTTAAGTCTATTGCCTCAATGAAGATTTGCATTCG
GTTTTTCCAGTAGTGGTAACCCTCTTCATTAAAGATAGGAGGCCTATTGATTGAATTTCCTTCTGGGAATAAGTAGTTTG
TTGAGGCCATTATTCTTGAAGCTTCTAAACTTTATACAAGAATGAAGCTCTGATACCACTTGTTAGACAAGTGGCCTCAA
AAATCTTAAGAAGTGGGGGTTGAATTAGTATTATGCTAACTATTCCCCCAATTAAAAACTACTCAGATTTTTATGCAAGT
TCTAAGTTCCCTTTATAACAAATTACTTAGATGATGAATCAAATGAGCAAATTGGAATGAGACTAATAAACAACAGTAAA
TATAAGAAATAAAGGGAAGAGAGAATGCAAAACCGGATTTATACTGGTTCGGTCACACCCTTGTGCCTACGTCTAGTCCC
CAAGCAACCCGCTTGAGAGTTCCACTATCTTTGTAAATTATTTACAAGTACTGAACCACACAAGGACTTTCCTTCCTTTG
TATTTATATTTCCTTTACAATAAGAGACTCACAGTCTCTCAAGCCTTTGAACAGAAAGAAGATGAACAGCAGATGATCTC
TCTAGAAAGAGATAGATATTACAATTGAGGCTCTTAATTCCTTATGAAAACACAAGTGTTTGGCCAAGGAATATTGAATG
ATAAAAGATTTTTGTTTAAGAGGATTATTCCTTTTGTGAACAGGGAAAACTCTTAAGAAAATTCATGCCCAAGTCACTTT
ATTTATAAGCCTTTGATGGCCATTCAAAAATCAAATGAAAAGATGTGACTGTTGGCAGATTTTCTGAAAACTTGCCACTG
GTAATCGATTACACAATTACCTTTCTTGAAAGTTGTGACTCTTCATTTTAAAATTTGAATTTCCAACATTCAGAGCCACT
GGTAATTGATTACATGTTCTGTGTAATCGATTACAAGGTTTTTCAAAATTTTTGAACGTTATAAGCACTAGTAATCGATT
ACGAACTCATGGTAATCGATTACACCTTTGAAAAACCATTGTCAGAAATGTTGGGCTTCTGGTTATCGATTACAGCCTTT
TGGTAATCGATTACCAGAAAGTAACAAGCTTGGAAAAATTATTCTTAAGATAAAAACTCTCTTGGCCAATCATTTGTGCT
TTTCAAAATCTTTTCTAATAGTCTATCTAAAACCTATCTTAATTCTTTTCTTGAGACCTTTGCCTTTGCTTGAAATCTTG
CTTTCTTCATTCTTGAATGATCTTTATATTTCCTTGGCATCATCAAAATAATTCTTGAAGCTTTGCTTCTACACTTACTA
CTCTCAAAACATAGAACCACGACCTCACACGAGAACTCAAAATACAGAGGAAGAAGGGAAACTCACTCGTGGAACTCACA
CGAGGAAGAATAGTCCCAAGGGATTGAGTTTTATTACTTTTTTTATGAATTAATATGATTACAATAAGATACTGCTATTT
ATACAAATGAAAGCAATGGGACCCGCTTAAATTCTAACCACCCTTTTTATTTTTGACCCTATACAGTTATTTTTATAAAC
TGAGTATTACA





USDA Logo
Iowa State University Logo