SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr472_Gm16-3
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr472
Description   SOLO
Chromosome   Gm16
Start Position   34548181
End Position   34548514
Sequence   TGTTATGAATCAACCATCAGACAATTCAAACCATGAGGAGGCAAGCACTAACATAATAGGAGCAGGATTGCTGAGTTGGC
ATTGCGGGATTGGGCCCTTGGATGATCCTGTCGGGAATATGCTTTTTCTGTTAGGATAATTGTTGCAATTATGTTATTGC
TAGCTTTCTCTAGAACCTGCAAAAAAGGAACGAATAATTAGTAAATGAAGCTTATAAATTGCCAACCCATGTAATGAATT
TGCAAGCAGAAATCAAAGTTTTCTTTCCTTATCTTATCCCTTTCTTTGGAGGAATTCTGGGCCCCGAACTCCAGAAACAC
CAGCACTCATAACA





USDA Logo
Iowa State University Logo