SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RLG_Gmr470_Gm6-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr470
Description   SOLO
Chromosome   Gm06
Start Position   18639034
End Position   18639440
Sequence   TGATAGGACCCAGCTAATTGAAGAATTGCCACATGAGCAGCTGATTCACCAGAGATCAAGTGGACCCAAGACTTGGAAGG
TGTATTCTAGAAGGAAGGGTAGAAAGGGTATTGGTGGCTAGTTAGTTACAATTGTGTGACGTGGTTAGGAGTGAGGAGAG
TACCATTGCACTTCCTGGATATAAGGAGTGGGAGGGGGAATATTCAAGGGGGGGGATTATTGTAATATTCTAGAATGTAT
AGGGAGCTTTAGCTTCCTATTAGGAGCCCTGCTCTTGTCAGATCTGTGGATTGTTATTTCCTTTTCTGTTATTGTCTCCA
TTGTTGATCATAATAATAAAGCTCTCTATTCCTCCATTTTACTATTTTTACTGTTTGATTGTTTTATTGCTATTCTGGTA
CGTATCA





USDA Logo
Iowa State University Logo