SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr453_Gm19-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr453
Description   INTACT
Chromosome   Gm19
Start Position   1636360
End Position   1637966
Sequence   TGGGTTGTTGATAGCAATTCAGCAGGCACTAAGTGATTGCAGACCCTCCACTTTAGTTAGTTACAACATTCCACTAGTTA
GTTAAACATGATCATTCTGTTATAACCATTTCCAATTCTGTTAGAACAATTAGTATAAGTATATCAAGTAGTGGAATGAA
TAAAGCAATCAGAACAATTATCTCCATTAGTTTCCTTCTTAGCTCCTTAGCAATAGTATGTAGTGTAGCTTTTCGTATCA
ATTGGTCCGACCTGCCCCCTTCTCTGTTGTTCTTCAATGGCAGATGTCGAACCTCTCGATGCCAGCCTGGACCGGCTCGA
GGCAGCCATGGCCAACCTCGCCGCAATGGATTCCGATCTCCATGCATCTCACCTTCGTTTAGACGCACTTCATGCTTCCA
TGCTCTTCAAACTAGATCTCATTAGCCAGCAACTGGATACCGTGATATTTCGCCAGCGCTTCCCGTTTCCTGCATCGATG
CCGCCACCACAGCCGTCACTGTCGCCGCCACTACTGTTTCCTTCTTCAGCCCAGCCACCATCGCCGCCGCTGTCACCGCC
ACCACTGTTTCCTTCTTCAGCGCCGTCGCCAGCTCCTCCGCCTCGTCCTCACGTGCCTCCTCCTCAGTTCACACCACACT
CCTACGATCCTCCTCAGCTTTATCCTCAGGAATGGGGCAACCCAAACAGCCCAAGGCAGCCCGTGCTTCCACACTCCTAC
GTTCCTCCTCCCCTTCCACTGCAGCCTTCGATTCCATGTTCCCCATCCAAGCCATCTAGTCCTGCACCCAAGTCTGCATC
ACTCCTTATGGCAGCTTACTTTGGACGCTCCATAAGGCAGTCACGCATACTCGAGCTTCCCGCCTCCACCTATTTTCGTC
GTCGTCAACAAACACGTCTCTCCTTTCTCAGTTTCTCTCCCTCTCACTCCTCTGACGACCAGAGAAATGTTCCCAAGCAT
GGTTTATGGCTCTGTCTTTCTCAGGCTCTTTCTTGCAACCGCCGTCCTCGCCGTCGTTCGCATCGTCGCCCTTCATCCTC
TTGCTCTGTCGCTCATCGGCGTCAACGCCCGCCGCCACATCCACCACCACCACCTCCGAAGCCCCCGCCTCCACCATCAT
CTCTGCCACCATCTTTAACACAACCCTTGATGGTTCCACGGTGTGGGCCACACACCCACTCCTTTCCTAGGCCGTTCAGT
CTGTGGCACGGGTCACACACTCGTTTACTGATTCAGACGTTAATATTGTTAGGCCCAACTAGCCCACAACCAAAGTCACT
TCCCTAACGTACCTCCTGTTTTCTAAACTCACCCCTATTTTCACTTGTTTTATTGTCCAACCTTGAGGACAAGGTTGTTT
TGAAGCGGTGGGTGTTGATAGCAATTCAGCAGGCACTAAGTGATTGCAGACCCTCCACTTTAGTTAGTTACAACATTCCA
CTAGTTAGTTAAACATGATCATTCTGTTATAACAATTTCCAATTCTGTTAGAACAATTAGTATAAGTATATCAAGTAGTG
GAATGAATAAAGCAATCAGAACAATTATCTCCATTAGTTTCCTTCTTAGCTCCTTAGCAGTAGTATGTAGTGTAGCTTTT
CGTATCA





USDA Logo
Iowa State University Logo