SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RLG_Gmr442_Gm12-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr442
Description   INTACT
Chromosome   Gm12
Start Position   6312799
End Position   6317843
Sequence   TGATAGCTACTGCTATATGGCGGGATAAAAGGGAAACTACAAATTATGCTAAAAATTGAGATAAGTATATTTTGCTCATT
CATTTCCACTTATTGCATGTTTATATAGCCTTCTAACAGAAAGCGATTTGGTTATAACAGAATGAAAATAACAGATTCGC
TCAACTAATTGGAATTGACATAATTGCCTATGGTAGTGGAATTTTGCTCTGCAAGTCTTCAAACGTATTCTCGGAGGTAA
TTGGGCCTTTTGACCAACCTTTTAGGCCTTTTAGCTTGTATGTTTGTAGGTGTGTGTTTTGCTGCTATAGCCTTATTGCT
ATCAACACTCTCGTCCCCAAAATCGACCTTGCCCTCAAAGTCGTATGCTCTGGCCAACTCGTCCCAGGACTCCCAAGAGG
TATCCTCGGGAGCTAATCCGGCCCATTGAACGAGGACCTTCTTGACTGGAGGAGAACTGGTATCGTCGTACTTCCAATCC
ACGATCATTAAGGGCTCGACCAGAGGATCGTTGTGGAGGGTGTTCGCAGGTAACTCGGCGGCGGAGCTTGGTAAAGGACC
GTGGTGGGGCTTCAGAAGTGAGACGTGAAACACCGGGTGAATTTTTGAATAAGGTGGTAACTGAAGCTTGTAGGCAACAG
GACCTATCCTTTCAAGCACCTAGAAAGGTCCATAGAAACGCTTGGCCAGCTTTGTGTAACCTGGAGCTAAGGAAGTTTGT
CGGTGGGGTCGCAAACGCACGTAGACACAGTCATTGATAGCAAATTGGACGTTGCGACGATGCTTATCCGCTGTTTGTTT
CATCACATCCTGAGCTTTTCGCAGACGGCGCTGCAGGGTCTGGTGAAGGGTCGTGCAAGTGGCGAGGAAGTCGTCCGCAG
CTTCGATGGTGGAAGTTCCTGGCTCATAATGGAGAAGGGACGGGGGTGGTTTGCCGTAAACCACTTCGAAGGGGGAAACT
CCTGTACTGGAGTGCATGGTTGTGCTATATGACCATTCTGCGAGGGTACGAAACCAATGTGAGGGCTTATTGTGGACATA
GGAACGGAGGTATTGTTCCAATGTACGGTTAAGAACCTCCGTTTGACCATCGGTCTGCGGATGGTAAGCGGTACTCATCC
GAAGCTTGGTACCGGACAAACGGAATATCTCCCGCCAGAAACTGCTGATAAAGATTGGGTCCCTGTCGGACACAAGGCTG
CGTGGAAAACCATGATGCTTGCATACCATATCGAAGAAGAGAGTGGCAACCTTCGAAGCTATGTGTTGAGCAGGCAAGGC
TCCGAAATGGGCGCCTTTGGAATATCTGTCTACGACCACGAGGATCACGGTGTACCCCTGCGACATGGGTAGGCCTGTGA
TGAAATCAAGGGACAGGTCTTCCCACACGTGTGATGGAATCAGGAGAGGTTGAAGTAAACCAGCAGTCTTCTTCGTGTCA
TACTTGGTTTGCTGACAAGTGTGACATTAGGCTACAAATTTGCGGACATCTGTCTGTATATGGGGCCAGTCAAAGGTTTG
ACGCAAACGATGCAGGGTCTTAGCGGCGCCGGTATGACCTCCTAATGGAGAGGAGTGGAATTCCTCTATGAGGAATGAGG
TGAACGGCGTCGGAAAAGGTAGCCATATGCGGCCACGGCGGAGGAGGAGATCCTTGTGAACTAATAAATCCTCGTGGGTT
GCCGGGGAAGATTGAACCTGCTGTAACAATTCAACATATTGGGGATCCTGCAATACAGCCTGACGGAGTTTGTCGAGGAA
GGTGACGTGAGGCATAGTCAGAGAGAAGAAGGTTGTTGCAGGGGCTGGAATTCTGGATAATGCATCAGCCGCAATATTCG
CGGCACCTGGTTTATACTTTATAGTATAATCGTAGCCCAACAACTTCGACAAGTACTGTTGATGCTCCGGCGTCTGGATT
ACCTGCGACATAAGGTCACGGAGACTTTTATGGTATGTTAGAATAGTAAAAGACGTACCCAACAGATAATGCCGCCATTT
GTGAACTGCAGAAGTTACAGCATGGAGTTCGCAGACATATGTTGAAGCCTTCTGCAATCTCGGGCAAAGAACCTTACTAT
AGAATGCAATGGGGTGGCCGTCTTGGGAGAGGACGGCACCGATAGCGAACCCAGAAGCATCCGTTTCAAGGATGAATGGC
GAGGTAAAATCGGGAGTGGCCAGCACAGGGGCCTGTGTCATCTGGTGTTTGAGGTCCCGAAAGGCTTGCTCCGAAGCCGA
TGACCAGCAGAATTGGTCCTTACGCAGTAGAGAAGTAAGTGGCGCAGCGATGGCGGCGTAATTACGGATGAACTTGCGAT
AAAATCCGGTCAGTCCCAAGAATGCGCGAAGTTCTGTGGGGGTGGTGGGTGTGGGTCAGGATACCATGGCCTGGACTTTA
TCCGGGTCTGGTGCGACGTCATGGGCCAAAATGATGTGGCCGAGATAAGTGAGTGCGGGCTGGGCAAAGAGACACTTTGA
ACGGTGGAGAAAGAATTAGCCCTCGGTCAAAGCGGAGAGAACAGAATTTAGGTGAATGGCATGTGACTGCAAGTCTGGGC
TATAGACGAGAATGTCGTCAAAGAAGACTGCAACGTATTTTCGCAAGAAGGGTCGAAGCACATCGTTCATGGCTGCTTGA
AATGTTGATGGCGCATTACAGAGGCCAAAGGGCATGACCTTGAACTTATAGTGGCCTTCGTGAGTTCGAAACGCAGTCTT
GGAGATATCGGCGTCCGCCATGTGAATTTGATGAAAGCCTTGTCTCAAATCAAGCTTAGAGAACCAAGCTATGCGTCCGA
GGTCATCCAAAAGCTCATCAATGGTGGGCATGGGGAAGCGGTCACGAATTGTCGCGGCGTTTAGAGCTCTGTAATCCACG
CAGCAACGCCAAGTTCAGTCTTTCTTTTTGACCAGCAAAATGGGGGAGGAAAATGGGCTGTGGCTGGGTTGGATAAGGCC
GGCGGTGATCATGGAAGTGATTTGCTTCTCAATTTCGGTCTTTTGGAAATGGGGGTAACGGTAAGGCTTAACGTTAATGG
GGTTGGTGTTTGGGAGGAGATGTATGTGGTGTTGGATATGGCGGTTAGGGGGAAGGGTAGTTAGCTCTTTGAAAATGTGG
GGAAAGTGTTCAAGGACGGAGATGATGATGGGAGGGGTGGGAAAAGAATTTGGTGGTGAGGACGAGGGAGGTTGGGCTGG
GGAAGTGGTGATATGAAATAAGGCAGAAATACTTTGTGTCTGGGAAAACCTCTTAATTTGGTGGGCTGATGCTGAAGAAG
GTCTGGGGGGTGCATCCGCATGTAAGGTGATGGTCTGGCCCAAATGCTCGAAGGTCATAGTGAGGGCCTGATAGTTTGTG
GTAATTGGGCCTAGTAGTTGAAGCCATTGTACCCCCAAGACTATGTCTGCTCCACAGATGGGTAAGTGGAAAAGGTCGAG
GGTAAATTGGTGATGCTGGATTTCGAGAGGAACTTGGGGAGAGAGCGTATCGCAATCAAGAATGTGGCCGTTGCCCACCA
TCACGCGAAGGGCCGATGTCGGGGTGGCGGGAAGGGCGAGAAATTTGGAAACCCGTGATTAGATAAAATTATGGGTGTTG
CCGCCATCTATCAATATGATGACCTGGTGGTGACGTATGACACCACGAAGGCGAAAGGTTTGGGGGGCTAGGGTTCCTTC
CATCGCATTCATACTTATCTGAGGTACCAGTAATGGGTCCTGTGAGGAAACCGAGGGCGGGTCGAGAGAAAACGGGTCCG
CGGGAGAGTCAGGGTCCTCATCCGCGATGAGTAGATGGAGGTGGGGCTTGCAGCGGTGACCATGAGACCACTTCTCCTCA
CAGTGGTAGCACAGACCCTGGTCTTGCCGGAGGGCCATTTCTTCAGTGGTGAGACGTTTCAGCAGAAGTTTGGATGGCAA
AGAAGCGGATGGGGTCAACGGCTTGGACACTAGTGGAGGAGGAGGCAACGAGGGTGGCCATGGGCCACGACGTCGATCCA
ACAACTTGTCTTCTTGCAGACGCGCGAGTTCCACAGCCTGAGGAAGAGACAAAGGACGAAGAGCCTGAACCTCGCGTCTG
AGTTTCAGAAGTAAACCGGAAACAAAGCAGCTAAGGAGAACCGAAGGGGGAAGTCCCACGATTCGGTTAGCTAGGCGCTC
GAATTGAGTGAGATACTCACTGACTATGCCTGTTTGTTGCAACTTGAACAAGGCCCCCTGAGGATCCTCGTAATAAGAAG
AAGCAAATCGCGATTCGAGTGCTTGAAGCATGGCGGGCCAGGAGGGGAAAAAACCATTACGCGACATCCACTGATACCAT
GAAAGTGCAGGTCCATCCATGTAGAAGGCTGCAACCGTCAAACGCTCAAGCTCGGGAATCCCCTGGTAGTCGAAGAATTG
GGATATCTTGAATATCCATCCGAGCGGATCTGTGCCGTCAAAACGGGGCACATCAAGTTTCATACGAGGACGATGGACTG
GAGAAGGAGGAGGTTGGGGTAGGGAGCTTGGGGAGGGAGGGGTGACAGTGATCGTGGCCAACCGTTCGAGGATAGATTCA
ATTTGGGAACTGAGGGAGAGATGGATAAAGTCCATTTTGGAGTTGAGTGTGGTGTGGTTCTGGCTGAGGGAATTATGGCT
CTGAGAAAGGCGGTTAATCGCTTCCTCAAGTTTGTCTGAGGTCACCTGTCTGGTGTGATGCTCTGGCATGATGAAGATGG
CAGGTCGGACCAGTGATAGCTACTGCTATATGGCGGGATAAAAGGGAAACTACAAATTATGCTAAAAATTGAGATAAGTA
TATTCTGCTCATTCATTTCCACTTATTACATGTTTATATAGCCTTCTAACAGAAAGCGACTTGGTTATAACAGAATAAAA
ATAACAGATTCGCTCAACTAATTGGAATTGACATAATTGTCTATGGTAGTGGAATTCTGCTCTGCAAGTCTTCAAACGTA
ATTGGGCCTCTTGACCAACCTCTTAGGCCTTTTAGCTTGTATGTTTGCAGGTGTGTGTTCTGTTGCTATAGCCTTATTGC
TATCA





USDA Logo
Iowa State University Logo