SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr43_Scaffold248-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr43
Description   INTACT
Chromosome   unanchored
Unanchored Scaffold   248
Start Position   7947
End Position   12567
Sequence   TGATAACCGTTAAATAATTGTATTTTGATAATAGAAAATAAGGTAAAATTATCTTTATAAATAATTATTTAGTAGTTATT
TGCGCTTAAATATTAAAGAATTGATGTTTTGTTGAATTTTGGCTGCAGATATAAAAACTGGAGGTGTAACAAGCAAAAAA
CTCAGAAAAATTGAAGAAAATAAAAAAATCTGAAGTAGGCCATGCCCAATATGTGCGCTTAGCGCACGTCACACGCTAAG
TGGGCCAGGAAGCACAGGCGCTAAACGAGACATTAAGCTCGAGAGTTGTCATGTGCGCTAAGCTTGCAAAACGCGCACTA
AGCGCGCGATCTACACGCGCTGAGCGAGGGGGTGTCGCGTTAAGCGCGCCTACGAAGGCTCAAAGCCCACTTCAGCAGCT
ATAAATAGAGAGTTAGTTCAAAGGAGAACAACACACCACCACAGAACCCCTCTCCCAAGGGTTTCATTTACTCCCTCTCT
TTCTTTCACCCATTCTCATTGTAAAGTCCTCAATGACCATGAGTGGCTAAACCCTTAGTTAGGGCCTAGCAGGCCTAAAA
GCAAACACGATGTATGATGTACTCTTCACTATTTATCAATGCAATATCAGGTTTTTCTTTCCTAATTTGTTTTTTGTTTT
TATCTTGCATACTCATCCTTATATTTTGTTAGGGATTAGATGCTCGGGAAAGGGTAACTTCTAAATAAGATTTAAAGAAG
ATATGCATGCATTAGTTTTACGAGTTAGACGCTCGGGAGAGGATAACTTCTAATAGAATAAGAAGAAAAGATATCATAAT
AAAATCATTGTTAGGCATAGAGTGATTGCATTATGCCCATGTTTGGAATATAGATAGGTAAAATAGGCTTGTCATCGTGA
GGCATCAGGGGCAAGGCAAGTAAATAAATAGATGTGAGTAGGATAGAATTACCTGAATTGGTAAAGAAAAATCATAAACT
AATACATCCTAGGCAGGCTAGGCAAGTCAGTTTCCAACATTATCTTATTTTATTTTGAAATTATCTTTTTTTATCTAAAT
CTTTTATCTTTCTTATCTTTCACTTTTCTAATCTTTTATCCTTTTCTTTATCTTTTAATTTTATCTTTAATTCCTTTATC
TTTTTCTTTATCTTCTATTTTTATCTTTAAATATTTATCTTATCTTTTTTATCTTTTATTTTTGAATTTTTATCTCTTGC
TTCTAAAATTGGATTTGCATTAATCTAAGTACAAACAAAGTTTTTGACGCCGTTGCCGAGGACTTTCGTACTTGATTATT
TGCATATTCCAATTTTAAAGCAATTAGTTTTCACTTTTTATTTTTTATTTTTACTTTTTTTTATCTATTTTTATTATTTT
TAGTTGCTTCATTTTTTTTCAATTTTTTTTCTTCTCTGTATTCATTCTTTTTTTATTCTTTTCTTTTTAACAAAGAAAAA
TAAAATTAAAAAAAAAATATTTATTCTGTGATAACGTGCATGGTAGTTATTTCTCTTATGAACAATGCACATTTCTTCTT
TGAAGAACTCATCATGGCAAGAGATCATCCACAGAGGATAACACTAGAGGATTACTCTAGTCCTATTATACTTCAATACT
TCACCAGGATAGTTAAACCAGAGGTGCAGACAGCCAACTTCTCATATCCATATTACTTGATCCAGCTAATTCAAGGGAAT
TTATTTTACGGCCTACCAAGTGAAGATCCATATGCACACTTGACCACATACATAGATATTTGTAACACGGTGAAGATAGT
AGGAGTGCCTGAAGATGCCATCTGCCTCGACTTATTTTGTTTTTCCTTGGCCGATAAAGCAAAAACATGGATTCGCTCGT
TTAAGGGGAATAGCCTGCGGACATGGGACGAGGTGGTGGAGAAGTTCCTGAAGAAGTACTTCCCAGAGTCCAAGACCATT
GAGGGAAAGGTGGAAATCTCATCCTTCCACCAACATCCTCATGAATCGTTGAGTGAAGCCCTTGATCACTTTCATGGGTT
ACTTTGGAAGACTCCTACACATGGGTTTAGCGATCCAATCCAGCTCAACATCTTTATTGATGTCTTACAACCCCATTCCA
AGCAGCTCCTCGATGCCTTAGCCGATGGGAAGATCAAGTTAAAGACTCCGAAAGAAGCTATTGAGCTAATAGAGAATATG
GCGGCCAATGATCATGTCATTCTACGTGACCAAGAGCCCAGCCCACAGGAAGAAAGCACTAGGCTAGAAGAATTGTTATT
ACAATTCATGCAGGAAACAAGGTCACATCAGAAATCTGGAAGTACAACTAGCTAAGCTAGTTGCTGAAAGGCCCACCGAA
ACCTTTAGGGTCAATACTGAGATGAAGCCCAAAGAGGAGTGCAAAGTAATTTTAACTGAGGAAGATGTGGAAGAAGAAAA
TAAGGAAGAGATAGAAAGAAATGAGGAGAAAGCACAACAATGGGAGAAACACTCACAAGTAGAAATTCAACAAGAAACCC
TCCTCATCAACTGATTGTCAAGTAAGAAAGACATGGAAAACATGATAAACCCTTAAGTGTCCTTCTCTCCTTGACCACCA
GCACTTCCCTTGCAACAATATGGAAGGTGTTTCCGGGATACATGAGTTTCATGGCGTCTCTAGCTAAGAGGCGAAAATGC
AAGGAAGATGTGTTTTATGTGACCTTCATGCCACCTTGAATGCATTTGACCCATCAAGCTAATGATGTTAAAGAAGCGCT
TACTGGGAGGCAACCCAGGATTTCTTACTTTATCTCTTTTAGTTAATTGCAATTTGTTTCTTTTAGGATAATTGTGTTAT
TTCTTTTTTTATTTTGAATTTTTGCATTTTGATTTTATGCATTTTAATTCCAGTACTTTAAATTTAGTCATTGAATAAAA
ATTGCATGATATTTGTGAAGAGACTATTTAGACTTTTTCTTATGGATTCAACACTTGAAATGTTGCATGACAATTGTGAA
AATACTGGTTTCCTGGAAGCAAGAGTCAGTCAAATAGTGGAACATGAATCACAAAGAGAGAAAAGGTTAGCTTGATGGAA
AGAGATCATGGTCCGGTAAGCCAATAACTTTATCTTGTCCCGGTGAGCTGTGTGAACTTAATTATGAGAGAACATCTGTT
TTTAAATTCCTAATTTTGCATCATTCTTAGACTGTTAGATTATTTACATAAGGTGGATATAATCAAGGCCATGTTTCTTT
TTTTATTTTAGCCACTTAGCCAAAACGCCAACTTGTGATGAAATTTATACCTTGCACCCTTGTTGAGCCAAAATTAGTAA
TTATTTTTCTAAATAAAACCCCTGAGCCTAATTATGATATCTTTAACCTTATTTTAGGGTTCTAAGAGAGCATAAAGGTT
TTGTTGAATTTTGGCTGCAGATATAAAAACTGGAGGTGTAACAAGCAAAAAGCTCAGAAAAATTGAAGAAAAGAAGAAAA
TCTGAAGTAGACCCAGCCCAATACGTGCGCTTAGCGCGTGTCATGTGCTAAGTGGGCCAGGAAGCACAGACGCTAAGTGA
GACGTTAAGCTCGAGAGTAGTCATGTGCGCTAAGCCTGCAAAACACGCGCTAAGCCTGTGATTCAACAGAAGCACGTGTT
AAGCCTGCAACACGCACGCTAAGCCCACGATCCAACAGAAGCACGCGCTAAGCCTGCAACAAGCGCGCTAAGCACGCGAT
CTACACGCGCTGAGCGAGGGGTGTCGCGCTAAGCGCGCCTACGAAGGCCCAAAGCCCATTTCAGCAGCTATAAATAGACA
GCCAGTCCAAGGAGGACAACACACCACAATAGAACCCCCTCTCTTAGGGGTTTCATTTACTCCCTTTCTTTCATCCCTCT
TCTCATTGTAAAGCCCTCAATGGCCATGAGTGGCTAAACCCTTAGTTAGGGCCTGACAGGTCTAGAAGCCATTGTAATGT
ATGATGTACTCTTCACCATTTATCAATGCAATACCAGGTTTTTCTTTCCTATTTTCTTTTATGTTTTCATCTTGCATACT
CATCTTTATATTCTATTAGGGGTTAGATGCTCGGGAAAGGGTAACTTCTAAATAAGATTTAAAGAAGATATGCATGCATT
AGTTTTAGGGGCTAGACGCTCGGGAGAGGATAACTTCTAATAGAACAAGAAGAAAAGATATCATAATAAAATCATTGCTA
GGCATAGAGTGATTGCATTATGTCCATGCGTCAAAGCAAACATCTAGAATTAGAACAACTTCAGGCATTTTATCTGTTGT
TGAGTCTTTGCAAAGGCATTTGGGAGATACCTGAATTGGTAAAGAAACATCATAAACTCATACATCCTAGGCAGGCTAGG
CAAGTCAGTTCCTAACATTATCTTATCTTGAATTTATCTTTTATCTAAATCTTTTATCTTTCTAATCTTCTATCTTTTAA
TCTTATCTTTAATTCCTTTATCTTTTTCTTTATCTTCTATTTTTATCTTTAAATATTTATCTTATCTTTCTTTATCTTTT
ATTTTAAATTTTTTATCTCTTGCTTCTAAAATTGGATTTGCATTAATCTAAGTACAAACAAAGTCCCTGTGGATTCGACA
CTCAGACATCCGAGTACTTCACTACTTGTGACAATTTGGTGCACTTGCCAAGGAGTCAACA





USDA Logo
Iowa State University Logo