SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr387_Gm7-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr387
Description   INTACT
Chromosome   Gm07
Start Position   17614285
End Position   17619462
Sequence   TGTTATGAATGCAAAACCAACACCAAGAACAGAGCAACACAAGGAAGAATAAGAAGCAAGGGCAAAAAGGAGAATCACCA
GACCAAGGTACCTGGATGACTACACACCCAAATGAGGACAGCAGCCACGTCAGCAAGGTTGTAGAAATTTGTCGTTAGAA
AAAGTTGTACCACGACCTCAAGGCAATCAATGCATTTTCTCAATTTCTCAATTCCTCTAAGGCTCAGAAGAAGCCAAAAT
ATATTAGGATTAAATTCTAGAATGATCATAGACAACTTATAAATAGAGGAAGAATGCAATTCAACAGATAAGCAGAAATA
ATTCTAGGAATATTGTGCTTGATCATAACATCTTGGTGCTTTCATTGAGCTCCATGGCATCCAACTCAAATATGGATCGA
ATAGAAGAAGCTATCGCCAAGCTTGCTTCTAGTCATCTCATCCTCACAGAGAAGCTCGATGACCTCATCAACCGTGTCGT
GAACCTTGAAACCATAGCCACCCACAACCCTTCACCCTCCTTTTCCTCAGCCACACCTACACCACAAACTCAACCAGTTA
TTCCACACAGACTCAAATTGGATGTCCCTCATTTTGATGGTATGGACCCATCGGGGTGGGTATTCAAAATTACCCAATTT
TTCGAATACCACTCAACCCCCGAGGCCGAGAGACTCACCATCGCATCCTTTTACATGGACGGCCCGACTCTTGCGTGGTT
CTAGTGGATGGCTCGTAACCATCAATTGTCGACCTGGTTTGGCTTCCTGCAAGCCATAAAGGCCCGATTTGCGCAATCAC
CATATGAGGACCCAACGGGTCTTTTTTTCAAATTAACACAAAGAGGTTCGGTGAAAGATTACCTGGCCCAATTTGAAGCT
CTCACGAATCACATCACAGGGTTGTCGTCAGCTTCCCTCTTGAGCTGCTTTATTTTCGGTCTCGATCCTGACGTCTGCCG
CGAGGTGCAAGCTCTTCAGCTGTTAACTTTGGTCCATGCCGCCAGCTTGGCCCGTCTTCAGGAGGAAAAGATCCTTGAAC
AACTCAAGGCGTTTCTCCACCGCACCAACTCTAACCCTCCAACCCTAACCCCAACATCCCTTTACTCCCTTCTCCGGCTA
AACCCCCTCCCTTACCCATCCATCGCCTGACCCCAGAGGAAATTGCCAGCCGTCGCGAGCGAGGGTTGTGCTTTCATTGT
GACGAAAAATTCACGAGGGGCCATTGTTGCTCCTCGCAATTTTTACTCCTCCTCGCAGACGAAGACCCACCAGACCACAC
CCTAAGCCCTTATAAAGACCCCTCTGACCCAATGAGCGACCCGAACCAGCCCGAAACACCACCCAACATTTCACTTACCC
AAACCCCACCTGAACCGCCCCAAGCCCAAATCAGCCCGCATGCCTTATTGGGCCATTCAACATCGGAAACACTCTGCATC
ACTGGCCGGATTTCTCACCACTGTGTCATCATTTTGATTGACGGAGGCAGCACACACAACTTTGTGCAAGAACACCTCGT
CAAGTCTCTTGGCCTGAACCCCCAACCAACTCCAACCTTACATGTCCTTGTTGGCAACGGTAATCAGGTTGAATGCTCTT
AAGTTTGCCTGAATGTCATCGTTCATATCCAGGGAAGAACCTTCTCTATTGACTTACATGTCCTCCCTTTGTGCGAGGCC
TACATCGTCTTCGGAGTCCAATGGCTTAAGTCCCTTGGTCCAGTCCTAACGGACTATAACAGTCTCACCATGAAGTTCAT
TCACGAGGGACAGTTGATTGAATTCAGAGGGACATTAGAATCACCATTAACGGCCATCTGCACTCCCCAGCTCTGGCATC
TCCTCCAAACACGCAGTGCCAATGAATTTTTCCACATCCGGGTGTGCCCTCAACCCACGACCACCTAACCCACCCACCCC
ACTATGCTCTCCATCATCAACCTCTTTCCCACCCTCTTTCAACCTCCAACACACCTTCCCCCTTCCAGACCCACCGATCA
TTCCATTCACCTTCTCCCTAACTCCTCCCCCATTAATGTCTGACCCTACCGCTATCCCCACTTCCAGAAACAGGAAATTG
AATCCCAAGTCAACACGATGCTTCAGAATGGCATCATTCGTCCCAATACAAGCCCTTTCTCTTCCCCAATTCTTCTTGTC
AAGAAAAGGGATGGCTCGTGGCGCTTCTGCGTTGACTACAGGGCCCTAAACGTGTTAACCATTAAAGACCGCTTCCCTAT
ACCGATAATCGACGAACTCTTAGATGAACTAGGTGGAGCTTGTTGGTTTTCGAAATTGGACCTACTTCAAGGATACCATC
AAATTCTAATGGCACTAGAGGATGTCAACAAAACAGCTTTTCGTACACATCACGACCATTATAAATTTCTGGTAATGCCA
TTTGGGCTTTGTAATGCCCCCTCCTCGTTCCAGGAAACTATGAACACCATTTTTGGGCCTCACCTGTGGAAATTCGTTAT
CTTCTTCTTCGATGATATTCTGGTTTATAGCAGGACCTTCTCCGATCACCTGGAACACTTGCGTCAAACCTTTCAGACCC
TTGCCGACAACAGCTTTGTCCTTAAACTATCCAAATGCTCATTTGCCACCCAGCAGGTCGAGTATTTAGATCACTTGGTA
TCGCAAGGTGACATAGAACCAGTACTAGAGAAAGTCGCCGCCGTACAGCAATGGCCACCTCCGCAATTAGTAAGGCAGCT
ACGTGGTTTCTTGGGGCTCTCCGGCTTCTACCGCTGATTCATCAAAGGGTATGCAACCTTGGCGGCACCTTTTACGACAC
TATTGACAAAGGATCAATTTCAATGGACATCGGAAGCTGCCACAACTTTCTCCAAACTGAAGGAAGCTCTATGCCAAGCC
CCTGTTCTGGGCTTACCTGACTTCTCAGTGTCATTCGTGATTAAGACTGGCGCCTCAGGCATCGGCATGAGAGCAGTTCT
CTCCCAACATCACCATCACCACCCTCTTGCATTCTTTAGCAAAACCTTTTGCTCGAAACTCCTCCGAGCGTCTACGTACG
TGCGAGAGCTAGTTGCGATCATGGCGGCCGTAAAGAAATGGAGGCAATATTTATTGGGCCATCATTTTATAATCCTCACA
GACCATAAGAGCCTGAAAGAGCTCATGGCTCAAGCAGTCCAAACTCTAGAGCAACAAGTCTACCTCACACGACTAATGGG
ATACGACTACACTATCCATTACCGTGCCGGCAAACATAACTTGGCAGCTGACGCCCTCTCACGCTTGCCTGATCCTCCAC
AGGGTCAATCTTTTATGCTAACCATTCCTAATTGTGTTTTCTTGCAGAAACTCAAAGCAGAGCTTGCCTCTAATAAGGAA
TTCCTTACTAGGAAGAAGCAAATTCAAGAGAAGCCACACAATCACCCCGAGTGCGTTCTCCGGGATGACCTGATACTACA
ACATGGGCGAATTTGGCTCCCACGAGGACTTCAAATTCTACAGACAATTTTGGCCGAATTCCACTCCACCCCCACTGGTG
GCCATATGGGGATCATGAAGACATTGGTTAAAGTTCATGAAAACTTCACCTGGGCATCAATGAAGCAAGACATTCATCAT
TATATCACCAATTGTATCACTTGTCAACAAATCAAAGTTGATCATCGTCGTCCAGCAGGACTCCTGTGCCCTCTTCCAAT
TCCGGCAAGACCATGGGAGGATCTCTCCCTGGACTTCATCACGAGTCTACCCATTTATCGTGGAAACTCAGTCATCTTGG
TAATTGTGGATCGCTTCTCAAAGGGAATTCACTTGGGACCACTACCCCAACATCACACAGCTTCCGACGTTGCTCAATTG
TTCATGGAAATCTCCGGCAAGTTTCACGGCATGCCACACAGTCTGGTCTCCGATAAGGACCCACTATTTGTTAGTCGTTT
CTGGCAGGAACTATTCAAAATGAGTGGTACCAAGCTCCGAATGAGCTCAGCGTACCATCCTCAATTTGACGAACAAACGG
AGGCCATGAATCGCGTTATTGAGCAATATTTAAGAGCCTTTGTGCATCAAAAGCCATCTACATAGGGACGATTCTTGATC
TGGGCATAGTGGTCATACAATACATCGACTCACTCCGCCACAGGGAAGACACCTTATGAGATCACTTTCGGCAAGCAACC
ACCAAGCTTGCCACAATATCTCGAAGGAAGTTCGAATGTCAATGTTGTCGATGAGTGGCTAACACAACGCGATGAAATAT
TTGCAAGCTTGGCAAAGAAGCTAGCCAAAGCCCAGCTACGAATGAAGGAATTTGCAGACCAATGGCGCCAGGATGTAAGC
TACGAAGAAGGAGACACTGTGTTGGTCAAACTACGACCTCGTCGCCAAACGTCAGCAACAGGAGGCACTTATTCCAAGCT
CGCAAAAAGATACTATGGACCATTCAAAATTGTTAAGAAGATTAGCAGTGTGGGTTACCAATTGAATTTGCCACCAACTT
CTAGAATTCATCCAGTTTTTCACTATTCACTACATAAGCCATATCATCCTTCTGATATTGAAGTCCCACCTAACCTACCA
GCATCCTCTGAAGGAAATGAACCTCTCATCACTCCTCTGGAAATTTTAGATGCAAAATGGGAAGAGACACCGACCAGCAA
CAATAGGTGATTACTAGTCTTGGTCCAATGGGCAGGTCTAGCCCCGAAAGATACCTCATGGGAACAATGGGAATCACTCA
AAAGCAGCTACAACCTTGAGGACAAGGTCGTTTTGGAAGCATACGGGGATGTTATGAACGCAGAACCAACACCAAGAATA
GAGCAACACAAGGAATAAGAAGAAGCAGGGGCAAAAAGGAGAATCATCAGACTAAGGTACCTAGATGACTACACACCCCC
AAATGAGGACAGCAGCCACGTCAGCAAGGTTGTAGAAATTTGTCGTTAGAAAAAGTTGTACCACGACCTCAAGGCAATCA
GTACATTTTCTCAATTTCTCAATTCCTCCAAGGCTCAGAAGAAGCCAAAATCTGTTAGAATTAAATTCTAGAATGATCAT
AGCTAAACAGCTTATAAATAAAGGAAGAATGTAATTCAACAGATAAGCAAAAATAATATAAACTTTTTCCCTTCTCTTTT
TTGTTGCTCTGGAGGCCCTAGACCTCGAATTCTAAGAATATTGTGGTTGAGCATAACA





USDA Logo
Iowa State University Logo