SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr341_Gm6-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr341
Description   SOLO
Chromosome   Gm06
Start Position   4577862
End Position   4578251
Sequence   TGTAATGGAGGAAATTAATGAAGGCAAGAATGGGAGGAATTTAGTAGCAGAGGAACACAAATGCAAGAGATAGTTAGGAA
ATATCTTCCATTAAAATAAGAAATCACGGTTTACAGCCACCAAAAGAAAAAAAACAGTAACCGCGCCACAAAGGAACAGA
ATGCTAGAAAGAAGAAGGAAGATCCAGAGAGAGAATGGGATCACACGATAATTCTTCCACACCCACTCTGCTATAACTGC
CTAATATAAATACTACTCCTTATGCCAATAGAAATCCTTCAATTTGGAATTTGGTATTTTGGGCCGGCCCCTCTCCTTAA
TTCCCTTGCTTCTTCCACACGATACTCTTCCTTGTCCAATGTCCTTTCTGCCCTTCCTTTCATTGTTACA





USDA Logo
Iowa State University Logo