SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RLG_Gmr296_Gm9-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr296
Description   INTACT
Chromosome   Gm09
Start Position   32103543
End Position   32108542
Sequence   TGATATGGCAGCTACTACCAAGGTCTGGCTTCAAGGGCCAAAATCTCCAGAGAAAGAAGAGAAGCTTAAGAAAGAAAGCT
AAGATTGAGAAGGATAGTATTTTTCTTATTGATTTGATGATTATTTACATAGATATATATAATGCCTACTGCTAACAAAA
TTGTCCTGGTCCTCTAGGAATATTTCTATAACAGAATTGGTTAGGAATATGTGTTCCCTACCAGCAAACAACATTATCCA
GCAAATCCTCACTGCCAGCTTAGCTTTTGCATTTTCAGACATAATCTTTGAGGTACGAAGGCCTGGTACTGCTCCTCTTA
GTCTTTGCCATTTGCATCGCTGCTTTTGCTATTGTGGTTCCTGTTTCCATTTCTGGTATTGCTTCTGATATGCTATTATC
TTCCTTCGGCCCTTGGAGAATCACCTTGTCCTCAAGGTGATGATCCTATCACAACTGGTCCCAGTCTTCCCAAGATGTTT
CATTAGGGGGCAATCCTCGTCATTGGACCAACACATCCCATGGAGCATCCTTGATACGGGATGAATGACGATAATCCGAA
ATAGCTAGAGGGGTAATTAAAGGCTGATCATTGACAAAGTGGTCTGGCAGTTGAGCGATGTTGGCTCTGTCTGGGATACC
ATGAAACGATTTAAGCATGGAGCAATGCAATACAGGGTGTATTTGAGAACTTTCTGGTAGTTGCAATTGATAAGCCACAG
TGTCGATACGGTCAATGATCTGGAAGGGACTGTAGAAGCGTTTAGCCAACTTGTCGGAAACTACTTGTGCTCCCTTGGCA
GATTTCTGCCGGTATGGATGCAGTTTCAGGCGAACCCAATCCCCAGTTTGGCAATTTATCTCTCTATGTTTGGCATCAAC
ATGGTGCTTCATGCTAGCTTGGGCTTTAATTAACTTTTTGCGAATGCTGTTAAACACTTCTTCCCAGTTAGTTAGTATCT
CATCAACAACGTCAAGGTTAGAAGTTCCAGAGAGATACTCTGGAAAACTGAAGGGCTTGCGACCAAATGTGATCTCATAT
GGTGTGGTCCCTGTGCTAAGGTTCCATGAAGTATTGTGGGACAATTCGACCCACAAAAGAAATTTTCCTCAAGCTCCGGG
TTGGCGGTGAACAAAAGCTTGTAAATACTACTCAATTACGCGATTCATAACTTCGATTTGACCATCACTTTGAGGATGGT
AAGCCGAACTGATGAATAAAGGGTCCCTGTTCGAGACCAAACTCCTGGGAATGCCATGTATTTTTACTACAATGTCAATG
AACAAGGAGGCCACCATATGAGCAGTATGTGCCGGCAGAAGTATACCCAAATGAATTCCTTTTGAAAAGTGATCAACAAC
TACGAGGAGAACAGTCTTGCCCTGGTAGGGAGGAAGGCCAGTGATGAAGTCCAAGGAGAAGTCCTCCCATGGACGAAATG
GCACTGGAAGGGGGCACAACAACCTTGCTATCCTCTTTGTCTCGTATACTGGCATTCGACACAGTTGGCCACGAACTGTG
TGATGTCATCCCTAAGTCTAGGCCAGTGCAAATTCTCCAAGAGCCTAGCTATCATCTTCGTGACCCCCATATGCCCTCCT
GTGGGTGTTGCATGATATTCAACAAGGAGAGAAGGAATTATTGGGAGGTCCTGCGGCAACCAAATGCGACCTTTCTTCAG
AATAAGGTCTTGAGTAATGGTGAAGTCAGGGTGTGATGCCGGAGAAGTCAAGATGTCTTGGTGCTAACTGCGGTATTGTG
GGTGACTGGCCAATTGCCGATGTAGTTCATCGAGAAAGGTCAAGCAAGGAACAAAGAGGATCATTGAGAGAGAAGATGTG
TGTTCTGGTAGCCTGAACAAAGCATCAACGACTTAATTATGAGTCCCAGACCTGTATTGAATGTGGCAGTCATACTCCAT
CAAGCGTGCCAGGTACATATGTTGTTCGGGAGTTTGTATGACCTGGGTCAATAATTCCTTGAGGCTTCGGTGGTCCATGA
TGATCGTGAATTGGTGGCCCAACAGATACTAGTGCCACTTCTTCACCGCAGAGGTAATCACAACCAATTCTCTCACATAT
GTCGATGCCTAGAGAAGCTTCTTGCTGAATGGTTTACTAAAATATGCTATGGGGTGGCCCCGTTGTGACAACACTGCTCC
CATTCCGTTGCCGAAGGAATCAGTCTCCACGGTAAACGACACTAGAAAATCAGGTAAGGCCAGAACAGGGGTTGTTGATA
GCACTTGCTTGAGTTGCTCAAAGGCTTTCTGGGCCTGAGACGTCCATGTGAAAGGTTCAATAGTGGCTGACTTGACTAGT
GGATCAGCAATCATCGCATATCCCTTGATGAACCGACGGTAGAAGCTTGCCAAGCCCAAAAAACTCCTCACAGCTTTCGT
TGACTGTGGTACGGGCTATTGAGAGACGACGGCCACCTTTGAAGCCACAGGTTTGACCCCCTTCTGAGATACAAGATGGC
ACAAGTATTTGACCTGCGGTTGGGCACAAAAACATTTAGATAGCTTCAGGACAAAGTGATTTTCGAGTAATACCTGTAAT
GTCATTTCCAGATGTCATAGATGATTGTCCAAGGAACCACTGTAGATTAGTATGTCATCAAAGAAGACGATGACAAAATG
ACGGAGGTATGGCCGAAATATCAAATTCATGGTAGCCTGAAAGGAGGACGGAGCATTGAACAATCCAATGGGCATGACCT
TGAACTCATAATGGCCATGATGTGTTCAGAAGGCTGTTTTCAGAATGTCCTTTGAGTGCATGTGAATTTGGTGATATCCC
TACAGTAGGTCGAGCTTGGAGAAGCACTGAGCACCACCCAATTCGTCAAGAAGCTCGTCAATGGTGGGGATGGGAAATAT
GTCCTTTATCGTGAGGGCATTTAAATCCCGGTAGTCCATGCAAAAGCGCCAAGAGCCATCTTGTTTCTTTACTAGCAGCA
CCGGTGAAGAAAATGGATTGGTGTTGGGCTGAATCAGGCCTTTCTAGAGCATTGAGTCAACCAGTAGTTCAATCTCATGC
TTCTGAAAGTGAGGATATCGATATGGACTCACATTAACCACATAGACTATGGGAGCAAATGAATATGGTGATTTGTGGCT
CTAGCTGACGGCAACGCATGGTGGGGGCGAAATAAGGCATTGAATTTGGTAATTTTGGAGTGGAAGGGGTAAGTCCTCCA
AGTGCGACGAAGGGAGGTCCTCAGAGAGGACAATGATATGGAAGTAAAGCTCATGTCCCTGTTTCCGATATAAACGGCGA
AACTGAGTGGATGTCAACAAACTCGAGTTAGCCTCACAGTCACCTTGCAGCTTGACTAAGCGCCCTTCATAGATGAATTG
CACACACAGTGTTATAGTTAGTGAGGACAAGTCCCAAAGATTTAAGCCACTGAACCCCCAAGACGACATTCATGCCAGCT
ATCGGTAACACATATAGATCAATAGTAAAGGAAATGTCCTAAATATCAATTGAAATGGCTTCACAAACACACGGGCACTC
CAGGTATTGCCCATTTCCCATCATGACCCGTAAGGGAGTGGTTTCGCGGCACGACAATCTTAACTGGGTCACAAGCTGTT
GTTGAACTATCGGGCGGGTCTGGGGGTGGAGTATCGGGTGGGTCAAAAATGGGTATATTAGAGGGAGTTGGGTTGTCCTC
ATCTACAATGAGGAGAAAAACCCTAGAGGCACAATGGTATCCTCTCTGGAATTTCTCTTCACAATTTAAGCAGAGACCCC
TTTCTCGTCGGGAAGCAATCTCTTCTGGGGACAAGCGCTTCAAGGTCGAGGGTTATGGGCGGGGAAGAGCTGGTAAAAGG
GGTGGAAGGGGCATCGCGGGTATCGCACGAAGAGGGTTTGTCGGCAGAATTGATGGTCGAGGGTGCGAGAGGTGGCGATG
ATCTAGAATCTTTTCCTCTTGCAGACGGGCGAGGTCGGCGACCTACACCAGGGTCAACGATTGATGGGCCTGTACTTCTC
GGTGTATCTCGGGTGTGGGCCTAGAGATAAAGCAATTGAGACCAATAATTCGATTTGCTAGATCCTCAAATTTCGTAGGT
ATTGAGCAACCATGCCCTTCTGAGTGAGCTTAAACAACGCGGCGGTGGGGTCATCGTACTGAGACGGCGCAAAGCGAGTG
TGCAATGCTTGAAGGAAAACCAACCATGATGTGAACTGGCTGCTAGTGTTCATCCACTAAAACCATGCAAGAGCACGACC
TTCCATATAAAATGATGCAATGGTGAGTTTGTTCTGCTCTAGAGTACCATGGTACTCAAAAAATTGGTTGATCTTAAAGA
TCCAACCTAGTGGCTTGGTGCCATCAAACCGAGGCACGTCTAACTTCATACGATGTGTGGATGCAGGGACAGGTGGAGGC
TGAGGCATAGGAGGTGGTCTGGGCAGAGATGACAAAAGGAAAGGGGCGACACACTGAAGGAGCTCATCAATCTTTAGGGT
CATGGAATTCACAGACTCGTTGAGGTACAGTTGCTAGTTGGTGAGGCGAATAAGGGCATCCTGAAGATGATCAGAGGACC
CCTGGTTCTTGTCGAAATCCGGCATAGAGACAATGAGAGAACCAAATTGATACGACAGCTACCGCCAAGGGCTGGCTTCA
AGGGCCAGAACCACCAGAGAAAGAAGAGAAGCTTAAGAAAGAAAGCTGAGATTGAGAAGGATAGTATTTTTTTATTGATT
TGCTGATTATTTACATAGATATATATAATGCCTATTGCTAACAGAATTGTCCTGATCCTTTAGAAATATTTATATAACAG
AATTGGTTAGTAATGTTCCCCAACAGCACACAACATTATCCAGCAAATTCTCATTGCCAGCTCAGCTTTTGCATTTTCAG
ACATAATCTTTGAGGTACGAAGGCCGGGTAATGCTCCTCTTAGTCTTTGCTATTTGCACCCCTGCTTTTACTATTATGGT
TCCTATTTCCATTTTTGGTATTGCTTCCGATATGCTATCA





USDA Logo
Iowa State University Logo