SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr293_Gm9-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr293
Description   INTACT
Chromosome   Gm09
Start Position   28873623
End Position   28878919
Sequence   TGATGCCAAGCTTTCGAGGGCTAGGGAACCTCCTTGCTCACAACGTGAAACCTAAGAGGAGCAATGGAATTCGCAGCGAA
GGAAGAAGGGTTCAGGCATGAGGGAAAGCATAGAGAAGAGAAGAGAGAGAGAACTCAGGAGGAAGAAGAAGCTTCTGGAT
ATTTTTCTTATCCATTATTCAAAGTTTACAGCTATTTATATGCTCATGGAACCAAGCTTAACCGTAAGTGGTTAGTTAGT
TGCCATGCCCTAACTAACTAACTACCCAAGCTTAAAACCCCCAATAACCACCTTTCCTGCCTAAGGTCCTTATGACCAGC
CCCTACATGAGCCTTCTCAGCCCATCTGATAAACGTCCCAATGCTTGGGCATCTTCTTCATTCGCCTCGATCGTTCCTGC
GTCGCGCCTTCATCTTCACCCAGGGCCTTGTCTTCTTCGTTCATAACATCCCCCCGTTCTTCAGACAAAACCTTGTCCTC
AAGGTTGTAGAGTTCCTTCAATTGCTGCCAATCTTCCCACGAGGCATCCTCTAAGGGTAATCCTTCCCACTGGACTAACA
CCATTCGCCTTGAACCTGCTTCGGAAGGGACTAGCTTGGAATCAACAATGGTCAAGGGAGTTACTATTGTTTCATCATTG
ATTATGGTAGGTAACGGATCCGCGTTCGCTGCCTCGGGGTCTCCTACAAATGCTTTTAGTAATGATACATGAAAAACAGG
ATGAATGCGACTGTGAGCTGGTAGTTTCAGGCGATAAGCAACCTTTCCTAACCTCTCCACCACCTTAAACAGGCCGCATT
ATCTCTTCGTCAGCTTTGAGTAGGGTGTTTCTGAAGCTGTGATTTGACGGTGTGGCTTGAGTTTTACCAAGACCCAATCA
CCTATGATGAATTCTTGAGGTCGTCTATGCGCATCTGTAGCCTGCTTCATCTTCTGCTGTGCCTTGAGTAACTTGCGTCG
AAGCAATTTCAAAACTTTGTCTCGTTGACTTAGCATCTCGTCAACCGCCTCTACCTGTGATGTGCCACCTAAGTATTCAG
GGATAGCTGGTGGTTTCTAGCCAAAAGTGATTTCAAACAGGGTTAACCCCGTACTGGAGTGGCATGAGGTATTATACGAC
CATTCTGCCCATAACAGGAATTGTCCCCACGACGTTGGCTTGCGGTGGACGAAGGCCCTCAAGTACTGCTCTACTATCTG
ATTTGCAACTTCCGTCTGGCCATCTGTTTGTGGATGGTAAGACGAGCCGAGTATGAGCTTGGTACCACTTAACTCAAATA
ATTCATTCCAAAATCTACTAAAAAACAATGGATCCCTGTCCGAGATAATGCTGCGAGGTAACCCATGAAGACGACTCACC
ATGGCCGTGAACAGCTCCGTCACCTTCCTCGCTGAATGCTTAGTGGGTAACATACCCAGATGTAACCCCTTCGAGAAATG
ATCCACAACCACGAAAATGCATGTGTGGCCCTTATAAGCCGGCAACCCCATGATGAAGTCCATACTTAAATCCTCCCACG
GTCGATATGGTATAGGTAAGGGACACAATAACCCCGCTGGCTTGCGGTTGTCATACTTCGTAAGTTGACAAGTCACACAT
GCTGCGATGAATGTACGAACATCACTCCTCATGGAGTTCCATGTGAAATTTTCCTGCAGCCTTTGTAGTGTCTTCTAAAT
TCCATAATGGCCTCCTGTTAGTGTACTGTGAAATTCCTCCATCAATAATGGAATAATGGAAGACCCAGATGGGAGCCAAA
TGCGTTGCTTGTATAGGATCAAGCCATTCTCAAGTTTATATTCAGAAGCTATGGCAGGGTCCTTTTGGATTTTCTCCTTC
AATGTTAGAAATTCAGGGTGTGCCGCTAACTCTCTTTTGAGATCAACAATGAAGGAGAACTATGGTGTCGAAAGCAGGTA
CAAGGAGGCATTGTCTTCTTCTCCGGCGACTCTGGACAAAGTGTCTGCCACACCATTCTCGCAACCTGGCTGATATTGGG
TGGTGTATTCGAATCCTAGCAAGCGGATTAGATAACGATGTTGCTCCGGCGTCTGCACCGCCTGAGTCATTAGGTCCCGT
AAGCTTTGGTGATCAGTGAGAATCACAAAATGATGGCCCAACAAATAATGGTGCCACTTTTTAATGGCCGTAGTTATCGC
TGCAAGTTTGTGAATAATAGCCCCTATTCCGGTACCAGAAGCGTCTGTCTCCACCACAAATGCGATGGGATGACCTGCCT
GGGAAATAATAGCCCCTATTCCGGTACCAGAAGCGTCTGTCTCCACCACAAATGGAATCTCGAAGTTTGGAAGTGCAAGC
ACTGGCGCGGTGGAGACTGCTTTCTTGAATGCGTTAAAAGCTTCAGTCGCCATCTCCGACCACTGAAACTGGCCTTTGCA
CAATAACTGGGAGAGAGCTGCTGCAATCTTGGCATAGCCCTTAATAAATCTCATGTAAAAACCCACCAAGCCCAGAAAAC
TTCTTAATGCTTTAACTGTTCGAGGGAGTGGCCACTCCTGAATCGCGTGCAACTTATCCGGCACCGGTTCCACACCCCTC
CCAGAAACCACATGTCCCAAATATTCGAGCTGTTCCTAAGCAAATGTACATTTAGAACGCTTCAAGGAAAATTTCCCCGA
GATCAAGAGTTGGAACGCGTTCTCCAGATGCACCAAATGGTCTGTCATTGTCTTGCTATAGATGAGCACATCATCGAAGA
AGACGATGATGAACTTTCGCAAGAAGGGTTGAAATAACTGATTCATGGTCGCCTGGAGTGTAGATGGAGTGTTACACAAA
CCAAAAGGCATCACTCTAAACTCGTAATGCCCTTGATGCGTTCGGAATGCGGTTTTGTTGATGTCTCATTCCTTCATTAG
AATATGATGATAGCCTTGCATCAAATCCAACTTGGAGAACCATCGAGCTCCACCCAGTTCGTCTAAAAAGCTTATCCACC
GTTGGAATGGGGAATCTATCATGCACTGTTATAGCGTTAAGTGCCCTGTAGTCGACACATAACTGCCACGACCCATCCTT
CTTCTTCACCAACAGGACTGGGGAAGAAAATGGACTAGCACTGGGCCGTATGAATCCCTTATCTATCATAGAGCTTATCT
TATCTTCTATTTCCTTCTTCTGAAAGTGAGGGTACCTATATGGTCGCACATTCACCGGAGCTGCATTGGGTAGGATGTTA
ATGGCGTGATCAGTGGTTCTCGAGGGTGGAAGATCCACTAATGGATGGAACAGTTGAGAGTATCGGTCAATCAAATCCTC
GATTTCTTGGGGTATCAGAGTAATTTCCCCGAGCGGGGACGAGTGGGGCTCTAATCGAATGTGAAACAACATGCTGGTAC
TATCTGCGTGTATCATGCGGCGTAACTATGATGAGGAGATGGATTCCAGGGCCTGTTCGTGCTCGCCCTGTAACTCCACT
AGGTGGCCGGCGACCATAAATTTCATCATCAACGTAGTATAATCAGTTAATACTGGCCCCAATGTTTTCAGCCATTGAAC
TCCCAACACTAAATCATCACCACAAATAGGTAAAACATGAAAATCTATAACAAAGGCGTGGTGTTGAATGGTTACCTCTA
TATCTGGACAAGTTTGCTGACACTATAGCTCGTCTCCATTGCCAACTGTGACCCTCAATGGTGACGTTGCAGTCATGTTT
AACCCCAGTGTCATAACTACCCTGTGATGCACGAAATTGTGCGTACTGCCTCCATCTATCAGAATACTCACTGGTTGTCC
TCTAATGTAACCCTGCATCCGTAGCGTTTCTGGCACCACCTAACCAGACAATGCATTGAAGCTTAACTGTGCTGGTGGAG
GATCTAGAACGGGTTCTAGAAGAAGAGGTTGCTGCTAATTAGACTTTGAAGCCGCATCGTCGTCTTCAACAATTAGCAGG
AAAAGGGAAGAGGAACACTTATGTCTTCTCGAGTATTTTTCATCACACTGAAAGCATAGTCCCTTTTCTCGCCGTACGGC
CAATTCTTCTGGAGTGAGTCTCTTGAATGGAACGCTGGAAGACGTTGTTCGTGCAGGTGTTGGTAACAGTGGTGAATTGG
TGGATGGAATGGGTAATAGCGGATGTCGAGAGCTTGAAGAAGCTCCTACAACTGACGAAGGTCGAAATGTCCTTCGTGCG
TCATTCTACTTTTCTTCTTGCAATCTAGCATATGCTACTGCTTGACTCAATGAAACTGGTTGCAGAACTTGGACCTCACG
GTGGATTGCCGGATTTAATCCAGAAATGAAACAACTCAAGGCAATTGAAGACAACAACCTTATGATTCGATTTGCTAAAG
CTTTAAACTCAGAGAGATAGTTGTTTACCGTCGTTCGTTGCTGCAATTTGCATAGCAAACCAGTTGGAACTTCGTATGTT
GTTGACACAAATCACGAATGAAGAGCATGAAGGAACGCTTGCCAAGACAATAATTGGCCGTTTCGATGCATCCACTGGTG
TCCTTCCATATAAAATGATGCGATCGTTAATCTTTCATGGTCTGGTGTTGTATGATACTCAAAGAACTGCGTTATCTTGA
AGATCCAGCCTGTGGCGTCAAAACCGTCAAATCTTGGAACATCGAGCTTCATCCGATGCGGTGCTGTGTGCAATCCTGAT
GCCGAGAATGATGTAGTCTCCGGTTGTGTTTGTTGTGGATTGTACCGATTTGCTTCGAGGTGCGACATTCATTCTGCAAG
GTTCTCCATCTTTGCCTCGAACGACGCTGCAAATTTTGTGAACAATTCCTCCATTTTTTCCGATGACAGAGCTTTCGACC
GCATGCCTTCCGCCATACTTGCTACGAAATGCGTCAATGAAAGCACCAATGATGCCAAGCTTTCGAGGGCTAGGGAACCT
CCTTGCTGACAATGTGAAACCTAAGAGGAGCAATGGAATTCGCAGCGAAGGAAGAAGGGTTTGGGCATGAGGGAAAGCAT
AGAGAAGAGAAGAGAAAGAGAACTCAGGAGGAAGAAGAAGCTTCTGAATATTTTTCTTATCCATTATTCAAAGTTTATAG
CTATTCATATGCTCATGGAACCAAGCTTAACCGTAAGTGGTTAGTTAGCTGCCATGCCCTAACTAACTAACTACCCAAGC
TTAAAACCCCCAATAACCACCTTTCCCACCTAAGGTTCTTATGACCAACCCCTACATGAGCCTTCTCAGCCCATCTGATA
AACGTCCCAATGCTTGGGCATCTTCTTCATTCGCCTCGATCGTTCCCGCGTCGCGCCTTCATCTTCACCCAGGGCCTTGT
CTTCTCCGTTCATAACA





USDA Logo
Iowa State University Logo