SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr17_Scaffold99-4
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr17
Description   SOLO
Chromosome   unanchored
Unanchored Scaffold   99
Start Position   53032
End Position   53760
Sequence   TGATGTGAATCTTACGGGGCGGATCGCTTGATACAGGCTACAGATATTTGGATGACGCCACTTCCGGTGAAGGAAGATAA
GTCAGGGTAGACGCCACTTCCGTTGAAGGAAGATAAGTCCGGGTAGACGCCACTTCCGGTGAAGGAAGATAAGTCGGGGT
AGACGCCACTTCCGGTAAAGGAAGATAAGTCTGGGTAGACGCCACTTCCAGTGAAGGAAGATAAGTCGGGGTAGACGCCA
CTTCCGGTAAAGGAAGATAAGTCTGGGTAGACGCCACTTCCAGTGAAGGAAGATAAGTCAGGGTAGACGCCACAAGGATT
ACCTTGATAAGTCTGATAATTGGTTCAACAAGGAACCCAGAGAGAAACTCTCACCCAATTTTATGAAAATGCCAAAAGTT
TCTTTTTTTATTGAAAATAAAAACCAATACTTATAGTGTATCTGAGTAAAAAGATAAAAATAGACATGGGCCTTCTAAAT
AGGTTGGGCCAAAACTACACTAAATAAAAATTATAACTAAAAACATATTTAACTTGGACCTTCAAATTAGTTTGGGCCTT
CAGCAACAATTAATTGTCTTGATAGTGTCTCTGGCTCTGGGCCTTCATCCTTCTCCACTTGGGCCTTCATCCTTCTCCAC
TCGGAGGCTTTGTCCTTCTCCACTTAGGCTTTCGTCCTTCTCCACTTGGGCCTTTTGCCTGTATTTGGCCAGTTTCATGA
TTCTCATCA





USDA Logo
Iowa State University Logo