SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr111_Scaffold79-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr111
Description   INTACT
Chromosome   unanchored
Unanchored Scaffold   79
Start Position   10016
End Position   15702
Sequence   TGATAGCATAGTAATGCCTGAGGTGCAAATAGCAGACACAAGTGCAGAATAAACAAAACCACATGAAGGTGAGGTACGAA
TAGCAAGTGGTATTAAGAGAAGGGTCTCTAGGCCCAAGTACCTGAAGGACTATGTTTGAACACGTTTGAAGCTGGAGGTT
CATGAAGATGATGCTGCAGGATCGTGCCCAACGGTCTTGATATTTTCCATTACCTTGATATTCCAATTTTGCATAAAAAG
ACAAATTCGGTTATTGTAGAATATCACTATAAATATCCTTATGTAAATAACAACATTATCAATAAGAATTTCACCTTCTT
TTTCATATTGCTTGTGGAGGTTCCCCTGGTCCTCGAATTCCAGGGATTCTCTAGCTGTGTGTATCATTTTGGTGCTCTCG
TTGCTATGCCTGATTCCTCTAATACTCCTGCTTCCTTAGAGGATGCCATTCTCAAGCTTGCAGCTCAGCAATTGTCCATG
GGTGAGACCTTACAAACAGTCACGTTCCAGCTGAATGAAATCCTTCATCGTCTTCCCCCTACGAGTCCCAACACAGGTCC
TGCCACAACTACCTCTGTTTCATCTTCTTCCCCTGCACACCATCACCGAATTAAAATTGATGTTCCTCGATTTGATGGGA
GTGACCCCTCTGGGTGGATCTTCAAGATCACCCAGTACTTCGAGTACCATTCAACCCCAGAGGCAGAGAGACTTACCATT
ACTGCATTCTACATGGATGGCTGTGCGTTGGCTTGGTTCCAATGGATGAACAACAATGGCCAATTCACGTCGTGGCCTGC
TTTTCTTCAAGCGGTTCAGACCCGGTTCGCTCCTTCCCAGTATGAGGACCCTACCAGCGTCTTGTTCAAGCTTACTCAGA
GGGGTACGGTGGCCCAGTACCTCGCCGAATTTGAGGAATTGGCGAACCGCATTGTCGGACTCCCCCCACCCTTCCTGCTG
AGCTGCTTCGTGTCGGGGTTGTCGCCGGACATTCGCCGCGAGGTCCAGGCCCACCAACCACTGACACTCGTCCAGGCGGC
GGGTCTGGCTCGTCTTTAGGAGGAAAAGTTCCTCGATGGCCGCACCCTCTCTCGTACTCGTCACCCCCAACCCATACACA
CTCACCCTCAACCCACACACACTCATCCTCAACCCAACCCCACCCACCTTGAACCTCTTTCCCCCAACCAGAACCCTAAT
TCACCCATGCCCCTGCGCTCAGTCCCTACCCCACCTATGCTACCACCACCCCTGCGTCCCACCCCTTCACCTGTGAAGCG
CCTCACCCCAGAGGAAATTGCCTCTCGCCGGGAGCAAGGGCTTTGCTTCACGTGTGACGAGAAATACCACAGAGGGCATC
GCTGTGCCTCTAGGGCATTTCTTCTGGTCGCTAAGGAAGACGAACCCCTCCCAAGCCTTATAAACCCCCCTGACCCACAA
CCCGACCCAGCCCCACCTGACCCAACTGACCCGTACCCGGCCTAGATTAGTTTTAATTCATTAGCTGGACAGGTGGCTCC
CGAAACGTTGCGTTTCATGGGCTTCATCGGAGACCGCCAGGTCGTCTTGCTGGTGGACGGTGGGAGTACCCACAACTTCA
TCCAGCTCCAGCTAGTTTCAGAATTGGGTCTCTCCACACGTGACACTAGCCCCTTGCGCGTCATGGTAGGTAACGGACAA
CATTTGGAATGCACGCGCGTCTGCGAGGATGTCACGGTGGTTATTCAGAGCACTCAGTTCACCGTTGACTTGCATGTGTT
GCCCATTGCCGGTGCGAACGTTGTTCTGGGGGGTGCAATGGTTGAAGTCCCTCGGACCGGTCCTCACCGACTATAACACG
CTATGCATGAAGTTCTTTCATACTGGAAATTTGGTAGAATTAAAAGGGGACACTGAGACCACTTTAAACTTCATATCTTC
CACCCAATTCCATCATCTCCGACGACACCAACCAACCAGTCTATACTTCCATGTTGTGATATTACCAGAGCCCCCTTCCA
TCCAAGCTAATCCTATTCCCCCTCCACAAATTCAGGCCATCCTTGACCGATATCACACTTTATTCCAACCACCCAGTGCT
CTTCCCCCGCAACGAGAGACCGACCACCATATCCACCTTCTGCCCCAAGCCACACCCGTAAATGTCCGGCCCTATCGTTA
CCCTCACTTCCAGAAACAAGAGATTGAGCAGCAAGTTGAACTTATGCTACAAAAGGGCATGATACAACCCAGCAATAGCC
TTTTTTCCTCTCTGGTCTTGCTTGCCAAGAAGCAAGATGGATCATGGAAATTTTGCGTGGATTATCGGGCACTCAATGCT
CTCAACATTAAAGACAGGTTCCCGATACCTACTGTAGATGAATTGTTAGATGAATTAGGAGGTGCTCATTACTTCTCCAA
GCTCGATTTACTTCAGGGGTACCATTAGATTCGTATGTGCCCAGAAGACATTTTGAAAACCGCTTTCAGAACCCATCACG
GACATTACGAATTTCGCATAATGCTGTTTGGGTTATGCAATGCTCCCTCATCATTTCAAGCCACGATGAACGCAATATTC
TGGCCATACCTCAGGCGCTTCATTATTGTCTTTTTTGATGACATATTGGTCTACAGTGCATCTCTGACAGAGCATCTTAA
TCACCTTGAAATTACTTTTCAGGTATTACTCACCCATCAATTTGTTCTCAAATTCTCAAAGTGCTTCTTTGCGCAGAATC
AAGTAGAATACCTGGGCCATATCGTGTCGTCGGAGGGAGTGAAACCAGTAGCCTCGAAGGTTGAGGCCATCCTGCATTGG
CCAATTCCACATTCGATTAAAGCAGTTAGAAGTTTTTTGGGGCTCGCCGGCTTCTATAGGCGCTTCATTAGAGGCTATGC
TACCATAGCTGCTCCTTTGGTCCACATCACCACGAAAGCCCATTTTCTGTGGACAGAAAAAGCCCAGGCCGCATTTGAGC
AATTGAAACTAGCAGTGTCAACGGCCCCTGTGCTATCGTTGCCGGATTTCGAGCAGCCCTTCACCGTTGAGACGGACGCA
TCCGGTGTGGGGATGGGAGCTATCTTATCTCAACAGGGACACCCATTGGCTTTCTTTAGCAAGCCTTTTCCCCTGAAACT
CTTGAGTGCATCCACTTATGTAAGGGAATTATTTGCCGTCACGGCGACAGTTAAGAAGTGGAGGCAGTATTTATTGGGCC
ATCGCTTCACCATTGTTACGGACCATAGAAGCTTGAAGGAATTATTAACGCAGGTCATACAAACCCCAGAGCAGCATACT
TATTTAGCAAGATTGATGGGATATGATTACCAGATAATTCATCATTCTGGAGCCTTGAACCAAGCTGCTGATGCTCTTTC
GCGTCTGCCAGAGCATAATTCCTCATTGATGATGTTATCGGTACCATGTCTTACTTTCATGGAGGAGCTCCGCCGGCAGC
TGGAAGCTTCCTCAGAATATGTGAATCAGAGGCAAGCAATTGGTCAATCTCCTACCACATTCCCAGGTTATTCAGTTGTC
AACAACCTCATTCTGCACCAAAAGCGCATATGGCTTCCCAGGGGACTTCCATTAATACCCACTCTGCTCACTGAATTTCA
CTCAACTCTTGCCGATGGACACATGGGAGTGGCTAAGACTTTAGCTTGAGTGTCAGAGAATTTCAGTTGGCCTGGTCTTC
GCATGGATGTAACAAAATTCGTTGCCCAATGCGTTGATTGTCAACTCACTAAGTACGAAACCAAGAAAAGTGTAGGTCTG
CTCTGCCCTTTGTCGGTTCCACAGAGACCTTGGGAAGATCTTTCCCTAGATTTCATAATGGGCCTTCCACCCTTCCAAGG
CAATTCCGTAATCTTAGTGGTCGTTGACAGGTTCTCTAAGGGCATACACCTGGGTATGTTACCAGCTTCGCACACAGTTC
ACATGGTGGCTGTCCTGTTCATGGAGATCGTGGGGAAAATTCATGGGATTCCGCGAAGCTTAGTATCAGATCGAGACCCC
CTGTTCCTCAGCAATTTCTGGCGTGAGCTATTCCAATTGAGTGGGACGCAACTTTGAATGAGTTCTGCCTATCACCCTCA
GACAGATGGGCAGACTGAGGTGATGAACAGAATCATCGAGCAATGCTTACGCGCATTTGTTCACCGGAGACCGCGGGTGT
GGGGGAAGCTCCTCTTATGGGTAGAGTGGTCTCATAATACCTCTTGGAACGCTGCGATGGGATCCACACCTTACGAGATT
ACTTTTGGACGAAAACCATTCAATTTCCCAGATTATATCACAGGAACTTCAAAATTGGATGCGGTAGACGAGATGCTCCA
AGACAGGGAGGAAACATTCCAATGTCTCAGGAAGAAGCTTCTTAAGGCCCAAACTCAGATGAAGAAGTTCACAGACACGA
AGAGGAGGGAAGTGTCGTATCAGCCCAGAGATTGAGTCTTACTCAAACTCAGGCCTCGCAGACAATCATCAGTGAAGGAT
AATCCTGGGGTGCACGGGAAATTAGCAAAGAGGTTCTATGGTCCATTTAAGGTGCTTGAGCGTGTGGGACCAGTTGCGTA
TCGATTAGAGCTGCCGGAAAATGCGCGTGTTCACCCTGTTTTCCATTGTTCAGTATTGAAGCTATTTCAGGGGACACCGG
AGTCTGAGATTCCGGCCCAGTTGCCGGACCAATTTTTGCAGGATCAACCCCTCATCTCCCCGCTTTCTATCTTGGATTAC
AGGAGGACCACCCCAGCAGACTCGTGGCAGGTGCTTGTACAATGGAAAGGGCTGACTCCTGATGACACGACCTGGGAAGA
TTGGGACACCCTACAGCAAGAATATCACCTTGAGGACAAGGTGATTCTGCAAGGGCCCCCGAGTGATAGCATAGTAATGC
CTGAGGTGCAAACAGCAGACACAAGTGTAGAACAAACGAAACCACATGAAGGTGAGGTACGAATAGCAAGGGATATTAAG
AGAAGGGTCTCTAGGCCCAAGTACCTGAAGGACTACGTTTGAACAGAACACGTTTGAAGCTGGAGGTTCGTGAAGATGAT
GCTGCAGGATTGTGCCCAATGGTCTTGATATTTTCCATTACCTTGATATTCCAATTTTGCATAAAAAGACAAATTCGGTT
ATTGTAGAATATCACTATAAATATCCTTATGTAAATAACAGCATTATCAATAAGAATTTCACCTTCTTTTTCATATTGCT
TGTGGAGGTTCCCCTGGTCCTCGAATTCCAGGGATTCTCTAGCTGTGTGTATCA





USDA Logo
Iowa State University Logo