SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr68_Gm9-3
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr68
Description   SOLO
Chromosome   Gm09
Start Position   33148588
End Position   33149738
Sequence   TGCAGAAGCAAAGCTTCAAGAATTATTTTGATGATGCCAAGAAATTTCAAAGATCATTCAAGATGAATTTCAAGGATGAA
GAAAACAATATGTCAAGCAAAGCAAAGATCTCAAGATAAGAATTAAGATAGACTCTTAGAAAAGTTTTTGAAAAGCACAA
ATGATTGGCCAAGTGAGTTTCTATCTTAACAAAAACTTTTCCAAGCATTTTACTCTCTGGTAATCAATTACCAAAGGTTG
TAATCGATTACCAGTGGCCACAAAGCTTTTTGGAAATATTTTCAAAGTTATTTTCAAAGTTTTCAAAGTTGTAATCAATT
ACCAAAACTATGTAATCGATTACCAATGCTTTAAAACGGTTAAAAATGATTTTGTAACTGTGTAATCGATTACACATCAT
ATGTAATTGATTACCAGAGTTTTTGAACGTTGGACATTTGAATTTTGAATAAAATTAACTGTGTAATCGATTATGCCAAT
GCTGTAATCGATTACTAGAGAGGATTTTTGAGAAAATCAGCCAACAGTTACAACTTTTCATTGGATTTTTGAATGGCCAT
CAAAGGCATTTAAATATGTGACTTGGGCACGAATTTTCTTAAGAGTTTTCACTGTTCACAAAAGACAAAATCCTCTCAAA
CAAAAATCTCTTATCTTCAAAAATTCCTTGGCCAAACACTTGTGTTATTCAATAAGAAATTGAGGGCTTCATTGAAACAT
CTGTCTCTTTCAAGAGAGATAATTTCTTCTTCTTCTTCTTACTTATGAAAAAAGGGCTAAGAGATTGTGAGTCTCTTATT
GTAAAACATCTGAGTACAAAGGAAGGGTTGTGTGTGTTTCAGAAGGTGTAAAAGATTTGTGAGATAGTGAAACTCCCAAG
CGGATTTCTTGGAGACTGGACGTAGGCAACGGACTTTGCCGAACTAATATAAAAACTGTATTTACACTTTCTCTTCCCTT
AAACTTTTTTATTTATTGTTGCTTATTGTTTCTATTCAGTAAATTTAATTTGAATTATTATTTAGGAATTCATTTTAAAA
GGAATCTTGGGACTTGAATTAAAATCAAAGTAGAATTTTTAATTGAGGAATAGTTTGTGATATTTTAATTCAACCGTCAT
TCTTAAGATATGTGAGACCACTTGTCTAACA





USDA Logo
Iowa State University Logo