SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr519_Gm17-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr519
Description   INTACT
Chromosome   Gm17
Start Position   33974554
End Position   33982523
Sequence   TGTTACACAATCTAGGATTTGATTATGATATGATAATAATTACTTAGTAAAGGATTTGATTATGATATATTTTAATCATT
CAGTCAACTCTTTGATATGATTGTAATTATTGTTAAATATTGTAATTAGCTTAAATAAGGATACCTACTTAATATAGAAA
AGATAGTAGCCTAGTTTCTAGAGATTTAGCTTATTTCTCTCCTAATACTATGTAACTGACAGTGTATTTACTTCTATATA
TTTTGTCTCTCAATCAATAAAACTGATAAGCTAGAGGTTTGCTTTCATGGTATTAGTAGCATCTCTATAATCAACTCTAA
TTTTTTTACCTCTGCAACATGTCTAATGACCAAGACACACCTACCACCAACCTTAATCTGGAGAGTCCTTATTATCTTCA
CTCTTCTGATAATTCTGGACAAACTCTTGTGAGTGACGTCCTTACAGGTCTCAACAATTACAATCCATGGTCTCTTGCCA
TGACAATGGCTTTAAAGGGCAAAAACAAATTTTGCTTTGTTGATGGCTCTTTCCCCTCCCCTGCATCCACTCATGCAGAT
TATCATCATTGGTCTCGTGTCAATAATATGGTCATGTCATGGATCCTCAACTCCATTGATCGCTCCCTGGCCCATACTGT
GCTTTATGCAGAATCTGCTGCTGCTGTTTGGGCAGATCTCAAGGCACGCTTCTCCTCCAACACTGGTCCTCGCATATACG
AGCTTGAGAAAAATATTGCTACTTTTCAACAACAAGACTTTTCAATTGCACACTACTTCAATCAGCTTCGCTCTCTTTGG
GATGAGTTATCCTTTATTGATCCTCCACCAAAGTGTACTTGCCAAGGTTGTACTTGTGGAGCCAAAGAGACTTATATCTC
CCAACAAAACAAACGACGCCTCATGCAGTTTTTGATGGGACTCAATGACACCTTCAGTCAACCACGAAGCCAGTTACTTC
TTACTACATCCCTCCCAGATGTTGCTCATGCCTATTCCTTTCTTCTCCAAGATGAGGCTCAAAAGGCACATACACATCCC
CCACTGACTTCAGAACGTGCAGCCCTCCAAACTCAAACTGAACACACATTTTTGGCCAAACAAACACCTTCTCGCAGTCG
TCCCTAATGTGCGCATTGTGGCATCCTTGGCCATACGGAGCATAAGTGCTATAAGCTTCATGGATATCTGCTAGGGCATC
GCTACTACCAAAAGGGGAACACTCATGGACAATCATCTACTTCATCCACTCGTGCTGACCAACGTAATGATGCTGCAAAA
GATCCCTTATCTGCAGATTCGTTACAACAGCTTCTTCACCTATTAAGGGAGGTAAACCAACCTAAGGCCAATCTCACAGG
TGAGTCTCTAGCTCTTTCTTCTGCCCTCTGTATGCTTACCGAATGGGTTATTGATACTGGCGCAACAGATCACGTTTCTT
TCACCCATTCCTCTTTTCAACAGCCACCTATTCCTTCTTCTCTTCATAAATCTATTTGTGTTCCTAATGGTCATTCGGTT
CCTATACATGGCATTGGAAATGCACAAATAACATCAGATATCATCTTGACTGATGTCTTATTTGTACCCCCATTCAAGTT
CAATCTTTTATCTGTGCCAAAACTCACCCAGACTACTAATTGTTCTGTTTTCTTTTATCCTGATCATTGTGTATTTCAGG
ACCATTTGACGAAGAAGGAGATTAGTCAAGGCCATAAAAAGGGTGTACTCTACTTTCTTGAAGTCTCTGCCTTTGTTGCT
GCCGTTATCACCACCTCATCCACCACTTGGCATGCTAGGTTTAGTCATCCATCATCCAGTGCCCTCAAGTGTTTAGCTCT
TGTTCTTGGTTTCAATAAAAACTCTTGTGACCATTGTGAAGTATGTCATTTGTCAAAACAAACAAGACTCCATTTTCCTT
TACACACCCACTAGCAGTAGTTTGTTTGAATTAATCCATGTTGATGTTTGGGGAAAGTATGCCACACCTACAAAAATGAT
CATCATTATTTTTTAACTATTGTTGATGATTTTTCCCGTGTCACATGGACCTATCTCATGAAATACAAGTCTGATGCATA
TTCTTTGTTAGTTCATTTCTTGGCTTATGTTCGCAATCATTTTCAGACATGTGTAAAAACAATTCGCAAAGATAATGGCA
CTGAATTTACAAATAATTCATTTCAGAAAATTCTGTGACTCTGGGATTCTCCAACAATTCTCTTGTCCAGGTACCCCACA
ACAAAATGGTGTCGTTGAATGTAAGCACCGACACCTTCTCAATGTTGCACGGGCTTTACGTTTCCAAGCCGACCTTCCAC
TAATTTTTTGGGGTGATCGCATTCCCACTGCAACTTATTTAATAAATCGCACACCATCCAAAATTTTAGTTGGTCAAACT
CCTTATGAAAAAATGTATAGCCATCCACCTGATTTCACTCACTTGCGTACATTTGGTTGTCTGTGCTATGCATCCACTTC
ACATGATCATCCAAATAAATTCGAACCTAGAGCTAGACGTTGCATCTTTGTGGGGTACCCTGCTGGCCAAAAAGCCTTTA
AACTATATGACATTGATCATCATAAATTTCTAATTATTTGAGATGTCATCTTTCATGAAACAATATTTCCATTCAAGAAT
AGTAAGGCTTTGCATGATTTACACATGGAACGACACCCTCTTCCTGTACCCATTTGTGATCAAGAACCCATAAATTCACC
AACCCCCACACCTCCTAGAAACACTTCTACACTCCCTCCTACTACAGAACCCAATGATAATGAACCCACACATACTGTTG
AACTCCTTGCAATAACTAACCTTGAACCAAGACACTCCGAACGTCTCAAAAAGCCTCCAGCTCGCCTTGCTGATTACGTG
TGCAATATGGCCTCTGCTCAATCTTCTTCCTTGTCTCCAGGTATGCAATATCCCATCTCAAACTTTCTTTGCTCAAATCC
TTACTCAAATAACCATCTCCATTTCATTAATTCTATTATCAAGCACATTGAACCAACCTCATACACTGTTGCCCGTAAAG
ATCCCCATTGGCGACAGGCTATGGAAGACGAAATAAAGGCATTAGAGGCTAACAATACCTGGACTTTTGAGTTTTTGCCT
CTCGGAAAAATGGTTATAGGCTGTAAATGGGTGTACTGTATAAAATATAATTCTAATGGCTCCATTGAACAGTACAGTAC
AAAGCACATTTGATTGCTAAAGGTTACTCACTACTAGAGGGATTTGATTTTACTGATGTTTTCGCTCCTGTTACTAAATT
AACTACTGTGAGGACTATTCTTAGTATTGCAGCAGCAAAAAATTGGCCAACTCATCAAATGGATGTTTCCAATGCTTTTT
TACATGGCCATTTACTTGAAGAAGTTTACATGCAGCTTCCTCTCGGGTTTCGTAAACAGGGGGAGAGTCGAGTTTGTCGA
CTCAACAAGTCACTTTATGGCTTAAAACAGGCACCTCGCACTTGGTTCACTACTTTTTCGAGTGCTTTGCTAGAGGCTGG
TTTTACTCAGTCAAAGGCTGATTACTCCATGTTCTTATTTACCCGTGCATCACATATAACAATTTTACTTGTTTATGTTG
ATAATATTGTCATTACAGGTGATAATGCGTTGGTTATTTCACTCCTAAAGAAATACCTTTGCTGCCGGTTCAACATAAGA
GATTTGGGCTCATTGAAATATTTTTTGGGAATTGAAGTGGCACACTCGAAGGCTGGAACTTTTCTTAATCAGCGGAAATA
TGCATTAGAAATTTTGCAAGACACAAGCCTTCTTGCTAGTAAACCAGTCACAACTCCACTGGATTACAATCACACTTTGG
TTGCTAATCATGGTGAAGTACTATCTGACCCTGCTTCATATCGATGATTGGTTGGTAGATTGCTATACCTTACAGTCACT
CGACCGGATATCACTTATGCAGTTAACTTACTGTCATAGTTTATGTCTTCTCCTCGTGACACACACTGGCAGGCAGCACT
TAGAGTGGTGAGATATATCAAATCTGTCTCGGACCATGGTATCCTACTCTCATCTAATTCTTCTTTACGCTTGCATGCTT
ATTGTGATGCGGATTAGGCTTCTTTCCCCAATTCTAGAAGATCAACCACTGGTTATTGTATATTTTGGGGTCCAAGTCTC
CTCTGCTGGCGAACCAAAAAGCAGTCAACAGTTTCCCGCTCCTCTGCCGAAGCGGAGTATCGAGCCATGGCAAATGCGGT
TAGTGAGCTTACATGGCTGCACACTCTTCTTCATGAATTGGGTATTCCACCATATCCTGCAACTTTATCTTGTGATAATC
AAGCTTCCCTCCATATAGCAAACAATCCAGTCTTTCATGAAAGAACAAAACATGTTGAAATTGATTGTCATTTTGTTCGA
GATAAAATTCAAGAAGGAAAACTTTGAACCACATTTGTCCCCTCAAATCAGCAATTGGCAGATGTCTTCACAAAGGCTCT
TCTTCCGGCTTCACATACTCAGTTAATTTCCAAGCTCATGTACCTTCCTAGTTCTTGAGCTTGAGTGGGAGTGTTACACA
ATCAAGGATTTGATTACGATATGATAATAATTACTTAGTCAAGGATTTGATTCTGATATATTTTAATCATTCAGTCAACT
CTCTGATATGATTATAATTATTGTCAAATATTGTAATTAGCTTAAATAAGGATACCTACTTAATATAGGAAAGATAGTTG
CCTAGTTTCTAGAGATTTAGCTTATTTCTCTCCTAATACTATGTAACTGACAGTGTATTTACTTCTATATATTTTGTCTC
TCGATCAATAAAACTGATAAGCCAGAGGTTTGCTTT





USDA Logo
Iowa State University Logo