SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RLC_Gmr503_Gm13-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr503
Description   INTACT
Chromosome   Gm13
Start Position   13753855
End Position   13756512
Sequence   TGTTAGAAAGTGATTCAAATAGTTAAGGGGTTAAATGCGGAGTACGATTATGATTAGAAAATGAGAACAACTTGTATCTT
TCTATTTTACGAAAAACTGATTCTTATAAATAGGTAGTTATCAGTGTTGTATAACTACTATTCATCATAAATCAGAAATA
GTTTCATTTTTGCATCTTTCTCAGTTGCATTCCTCTTTTTCTCCAACACAGTGGTATCAAGAGCAGGTTCTCGGTTAAGG
GACAGAAGAAATGGGATCAACTGGTGTGAATTTTTCTGTGAATCTTCCCGTCCTTAATGGCAAGAACTAGGATCGATGGC
GTGTACAGATGAAGGCAATTATGGGTTATCAAGAAGTGGCTGAAATTGTTGAGGAAGTTTATCCCACAAACACTGAAGGC
TCCACAGAAGCACAAAAAGTCCTTTACAGAGAAAACAAGAAGAAAGATTGTAAAGCTATAGTCTTGATTCATCAGTGTAT
AAATGATGCACACTTTGAGAAGATTGCAGGCGCTGCAACTTCATGAGAAGCATGGAAGATCTTGGAGAAATGTAATAAGG
GTGCAGAGCAATTGAAGAAGGTGAAACTACAAACGATGAGGCATCAATATGAATTAATGCAAATGGAGAACAATGAGAAG
ATAGTTGATTTCTTCAATAGAATCATCACCCACACAAATTCTATGAAGAACTATGGTAAGAAGATTTCAAACCAAACAAT
TGTAGAAAAGATCCTGAGAACTCTTAATCCCAAGTTCGACCACATTGTCATAGCCATTGAAGAATCTAAGAAACTTAAAG
AAATAGCAGTAGAAGAATTTCAAGGTTCTCTTGAAGCACATGAACAAAGACTCATTGAAAGAGAAATAGAGAAGCCAGGG
GATCATCAGGCATTGCAGGCTCATACATCAAAGAGAGTAGGCAATAATTCCGAAGGTAATTTTAGAGGTCGTGGACGTGG
GAAAAATTTCAAAAGTAGCTTTAAAAGAAACACACAAAATCAAGAACAAGAAAAAAATGAAGAAGATCAGCCAGAAAGCT
CTAACAGAAAAAGGAATTTCAATAACTGGAGAGAAAAAAAGAAAAAGATAGTTGACAGGAAAAGAATCAAATGTTTCAAT
TACAATCAGATTGGATATTTTTCAACAGTGTGTGGCCACGCCAAGTAGCATAGATCACAGGGGGAATCAATCACACAATG
ATTATCAAGCACATATGGCCAAAGAAGAGAATGAAGCAGACTTTGAAGAACAACCCTTGATGCTGATGATGATTACCGAT
TCAGAATCTCATAATAATGAAACTTGGTACATAGATTCTGGATGCTCAAACCATATGACTGGACATAGGGATTGGCTTGT
CAATTTTGATGCAATGCAGAAGAGTAATGTAAGGTTTGCAGACAATAGAGTTATGCAAGCTGAAGGAGCGGGAACATTAT
CATACTTTCTAGGAGTAGCTCAATTGGGATTGATCTATCACTTGTCTATATGTGGATGATCTATCACTTACTAGGAGTAG
CTCAATTGGGATTGACTCACTAAAACAGAATTTGAAGAAGGAATTTGAAATGATAGACCTGGGAACATTATCATACTTTC
TAGGATTGGAGTTTGCATACAGTGAACAGGGAATTTTCATGCACCAAAAGAAGTATATTTTAGATGTTTTGAAAAGGTTT
AACATGTGGAATTGTAACCCAACAAAAACTCCAACAGGGGTGAATTTGAAGCTTGCAAAAAGTGAGAATGAAGCCTCAGT
TGATGGAACCTTGTTCAGACAGATTGTTGGTAGTCTAAGATTCATCTGTCACAGCAGACCAGAGATCACATTCAATGTTT
GACTTATGAGTAGATTTATGAGTGACCCTAGGCAATCACACTTGCTAGCTGCTAAAAGGATCGTGAGGTATCTAAATGGA
ATCATTTTCCCTCATCAAACCAAAGAGGATGATAATCTACATCTTGTAACCTATTCAGATTCAGATTGGTGTGGAGATTT
GGTTGATAGGAAAAGCACTATGGGACAGGTATTTCTACTGTCTGGCTCTCTCATATCCTGAAACTCAAAGAAATAATCAG
TGGTGGCATTATCAACCTGTGAGGCAGAATATATTGCAGCTTGTTCAGCTACTTGCCAAGCACTTTGGCTTTCATCCCTG
ATTAATGAATTAAAAGTATCTTTGGATGAAGCTATTGAACTAATTGTAGACAACAAATCAGCTATAGATTTTTCCAAGAA
TCTGGTATCTCATGGAAAAAGCAAGCATATAGACACTAAATTTCATTTCCTCAGAGATCAAGTAAGTAAAGGCGGAATTA
AACTAAGGCATTGCAGGTCAGAAGTTCAATTGGCTGATATAATGACTAAGTCATTGAAGGCTGAAAGATTTAAAGAGTTG
AGAAAGTTACTGAATGTAGTTTTCTTCTAAGCTTTTGAATCAAGGGGGGGTGTTAGAAAATGATTCAAGTAGTTAAGGGG
TTAAATGCGGAGTACGATTATAATTAAAAAATGAGAACAACTTGTATCTTTCTATTTTACAAAAAACTTACTGTTATAAA
TAGATAGTTATCAATGTTATATAACTACTATTCATCAGAAATTAGAAATAGTTTCATTTTTGCATCTTTCTCAATTGCAT
TCCTCTTTTTCTCCAACA





USDA Logo
Iowa State University Logo