SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr45_Scaffold1179-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr45
Description   INTACT
Chromosome   unanchored
Unanchored Scaffold   1179
Start Position   484
End Position   5102
Sequence   TGTTGATGTGAATAGAAGTTAAGAAGTTAGTGGTAGTTTCTTGTAATTAGGAGTTATGTGGAGTAGTTATATGGAGTAGT
TATGTGGAGTAATTTTAAATATATTGTAACTGCAATAGTCTATATATTTGTAACTTTGTAACTGCAGTAGTTGAATTTGA
AGATTAAGAAAAAGAGCATTCTCTCTAAAACTTGTATGTCATTGTTCTTTTTAACAATTGGTATCAGAGCTCCATTGTAG
GGGCCTGATATTGAGTGCATGTGAGGAAAACAGTGAGTGTGTGAGGAAAACAGTGAGTGTGAGTCAAGAAAGAAACTGCA
ATTTTTCTTTCTTTCGAGTAGAACGAGTTGAGAAGAATGGCAGAAGGTGGGAGTAGCAGTTTTGTGCAGCCTGCAATTCC
AAGGTTTAATGGTCATTATGATCATTGGGCAATGTTGATGGAGAATTTCTCTGCTCCAAAGATATTGGGATCTCATTGAG
AATGGGATATTGATGGTGGCCGATGGAATAGAGCCTACAGAGGCACAATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
GTTGCCTTCGGTCAAGATTCCAAAGAAGATATGCATAGAATGTTAAACTGGAAAGCACACAGAAATATATGCCTAAGAAG
AGTTTATGGAGAGCATCAAACAAGTTACAACTTGTGCATGCAGACATATGCAGACCTATTAAACCAGAATCAAATAGCAA
CAAGAGGTACATCCTAAGTTTTATTGATGATTTCACTCGTAAAACTTGGATTTATTTCTTACATGAAAAATCAGAAGCTT
TTTCCATGTTTAGAAATTTTAAAGCTCTTGTTGAAAAGGAGATTGGTGCATATATTGCTTCTTTGAGGACAGATAGAGGT
GGTGAATTTACCTCAAATGAGTTTGTAGAATTTTGCAAAAATCAAGGCATTAGTAGACAATTGATTGCAGCCTATACTCC
TCAACAAAATGGAGTTGCAGAGAGGAAAAATAGAACGATAATGAACATGGTGCGTTCTATGTTAGCTAAGAAGCAGGTTC
CTAAAATGTTTTGGCCCGAAGCAGTAAAATGGAGTGTGCATATCCTCAATAGATGTCCTACTATGGCTGTGCAGAACAAA
ACTCCAAAAGAGGCATGGAGCAATGTGAAGCCAATGGTTTATTATTTTCGAGTTTTTGGGTGTGTAGCTCATGCACATGT
TCCAGACCAGAAGAGAAGCAAATTAGATGAAAAAAGCAAGAAGTGTGTTTTATTGGGAGTAAGTGATGAATCAAAGGCAT
ACAGATTATATCATCCAGTTTCCAAGAAAATCATCATTAGCAAGGATGTGATTTTTCAAGAAGATGAATGCTGGAATTGG
GGCAAAAGCAATGAAGAATGCAGATCAGATGTTTTAAAGTGGAATGATGATGGTGATGAGAATAACATGGAAGAAGGAAT
AGAAAACAATGAAGAAGAAGGTAACATTGAAGGAGAAGGCAGTGATGTTGATACAAGAAACTCAAGTGAAACTGGTGTTT
CTTCTAGTGAATCAACTGAAAATGATTCACCAATTTTGAATGAAGAAAGGGTAAGAGGACCACCATCTTGGGCAATAGAC
TATGTAACAGGTGAAGGTTTGTCAGATGAAGATGGTCTGAATGCTATGATAATGCTCACTGAAGATGACCCACTTACATT
TGAACAAGCTGTCAAGAGTAAGAAGTGGAGGGATGCAATGATGGCAGAGATAGAGTCAATAGAAAAGAACAAGACTTGGG
AGTTAACTATTCTACCGAAAGGGGTGAAGCCAATTGGAGTTAAATGGGTTTTCAAAACCAAACTTAATGAGAAAGGAGAG
GTAGACAAGTACAAGGCAAGGCTAGTGGCGAAGGGGTATGCACAACAATATGGAGTTAATTATACTGAAGTTTTTGCTCC
AGTTGCTAGACTTGACACCATTCGATTAATACTTGCTTTGGCAGCACAAAACAATTGGGATGTTTTTCAACTAGATGTAA
ATAGTGCATTTCTTCACGGTGAACTCAATGAAGAAATATTTGTGCAACAACCATTGGGATATGAGAAGAAAGGTGAAGAA
GACAAAGTTTACAAGCTAAGAAAGGAATTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGGATTTT
TGTGTGTCAAAGAAAGTATGCTCAGAAATTCTAGGAAGGTCTGGAATGGATAAATCCAGGCACGAAATTGTCAAAGGATG
AAGCAGGAACCAAAGTGGATGAAACTTTGTTCAAACAGGTAGTTGGTAGTCTGATGTACTTGACTGCAACTCGACCTTAT
TTGAGGTATGAAGTGAGTCTTATTAGTAGATTCAGGTCTTGCCCAACTGAATCTCATTGGTTTGCAGCAAAAAGAATATT
AAGGTATTTGAAAGGTACAACTGAGCTTGGCATTTTCTACAAAAAGGATGGTTGCACAAATTTGGTGGCTTACACCGACA
GTGATTTTGCTGGTGATTTGGATGATCGTAGGTGCACTTCTGGCTTTGCATTCTTACTTGGTTCTGGAGCAGTTTCATGG
TCTTCTAAAAAACAGCCTGTAGTGACATTGTCTACTACTGAGGCTGAGTACATAGCTGCTGCGTTTTGTGCCTGTCAGTT
TATTTGGTTGAGAAGAGTTTTAGAGAAACTTGGTCATAAGGAGGAAAATAGTACTTTGATTCAATGTGACAATAATTCTA
CTATACAGCTATCAAAGAATTCTATTTTTCATGGCAGAAGCAAACATATTGATATAAAATTTTATTTTCTTAGAGATTTG
ACCAGAGACAAAATTGTGGAGTTGAGTTACTGTAATTCTCAAGAACAAGTTGCAGATATAATGACAAAACCTCTCAAGTT
AGAATAATTCTTGAAATTACGGAGTATGCTGGGAATGGTTGATGCGTCAGTTATAAACTAAATGTTTGTTTTTCTTTTTA
GTTTAAGGGAGGGAATGTTGATGTGAATAGAAGTTAAGAAGTTAGTGGTAGTTTCTTGTAATTAGGAGTTATGTGGAGTA
GTTATATGGAGTAGTTATGTGGATAATTTTAATATATTATAACTGCAATAGTCTANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAT
TGAAGATTAAGAAAAAAGAACATCTTTCTAAAACTTATATGTCATTGTTCTTTTTAACA





USDA Logo
Iowa State University Logo