SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr44_Scaffold121-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr44
Description   INTACT
Chromosome   unanchored
Unanchored Scaffold   121
Start Position   19617
End Position   24453
Sequence   TGTTAAACTCAGAAAAGGTTAGGCCAAAAACTGCTGCTCCTCATAGAGATTTCTCATATAAATACACTTTAATTACAATC
TGTCAAGCTGATTTTCAGCCCAATAAATAGCTAAACTGCCATATACACAATTACAGCTAATTATCCTGATTTTCAGCCCA
ATAAAATAGCTAAACTGCCATATATACAATTACAGCTAATTATCCTAATTAAGAGAGTAATTGTTACAAATAAATGTGCA
ATCCCATACAATTTGTTGTGACATTTAATTCCGTGCTGTGACATTTAATTCCGTTGACATCCCCCCTCAAATTGATGCCC
GAAAATCGACTAGCATCAATTTGCTAAGAAGAAAATTGTGTCGCTGACGTGTTAATGTTTTAGTGAAAATGTCAGCTATT
TGAATGGAAGTTGAGATGTGTGGTAGACTGATGACTCTTCGATCATAGGCATCGCGAATAGAGTGACAGTCAACCTCAAT
ATGTTTAGTCCGTTCATGGTAAATTGGATTCGCTGCAATCTGTATGGCACTGGTGTTGTCAGCATGCAGCGGAGTTGGTT
GTGCTTGAGAGAATCCAAGCTCTATGAGGAGACCACGTAGCCATATTATTTCGGAACAAGCGGCAGACATCGCGTGATAT
TCTACTTCAGTGGAGGACTTTGAGACTGAATCTTGTTTCTTACATTTCCATGAAATAGGAGCATTCCCTAGGAACATACA
CCAACCAGTAGTGGATTTTCTTGTGTCTGGACAACCAGCCCAATCAGCATCACTGTATGCTTGGAGTTGTATGGAGGAAT
CAGCAGGAAAAAACAGACCATGCTTTGGGGTACCAAGGAGGTATCTAATGATCCGTTTTACTGCTGAAAGATGCAAATGC
CTCGGAGATTGCATGAACTTACTCACGGTGTGGACAGCAAAAGAAATATCTGGACAAGTGATAGTTAGATAGATGAGACT
TCCTACGAGCTTGCGATAGTGAGTGGGATCATCAAGAAGTTCACCTTCATCTCTCCGATATTTAACATTAACTTCCATGG
GAGTGTCAACAGGGGTGGCATTTGGGAGTCCAGCTAGTTGAACCAAGTCTTGAATATACTTGTGCTGACATAGAGAAATG
CCTTGGTGATGATAATGCACCTCTAAACCCAAGAAATAAGTGAGATGGCCTAAGTCTTTCATCTGAAAGGTTGAATGCAA
CTGATTTTTTATTCTAGAAACAACATCTTGATCTGAACCAGTGACCACAATGTCATCCACATAAACAAGAAGCACCACGA
TGCCTTTAGGAGTCCTTTGTAGGAAAAGAGAGGGATCATACTGACTTTGAGTGAATTCAAAAACAAGTAGTGTCGAGCGA
AACTTTTCAAACCGTACTCTTGGTGCCTGTTTTAATCCATATAAAGAGCGTTTCAGTTTGCAAACAGTATTAGGTGAAGG
GGTAGGCATACCATTAGGAAGCTTGATGTAAACTTCCTCCTTAAGGTCACCGTGAAGGAATGCATTTTTGACATCCATTT
GATGTAGTGGCCAAGATTGTGAGGCAGCAAGAGCAAGAATAGTGCGCACAGTTGTCATCTTGGCGACTGGTGCAAAAGTC
TCATCATAGTCCAGTCCATATTGTTGCTTATTGCCAAGCACAACTAAACGAGCTTTGTAACGATCTATGGATCCATCCGA
ACGCAGCTTTATAGAGAATACAAACTTGATACTTAAAGGCTTAATAGATGTGGGACACGGGACTATATCCCATGTTTGAT
TTTCTTCCAATGCTAGAAGTTCAGTTTCAATAGCTTTCTGCCAACAAGCATTCTTCATGGCCTGGCTATAAGAGGAAGGG
ATAGGAATAGAGGATAATGAGGCTGTCATGGAATGGATATACCTGTCTGGGGGCTTAATAATGCGTGAGCTGCGTCTTGG
AGGAGCTGGTTCTGGTTCTTCTACTGGATCAGCAGCCAAGGAATTATCTCGAAGGGGCCCTTGAGGTTCTGTCTGTTGAT
TTTGGTTTGCAGTGCTACGTCTGTTGTAGGTCAAGAGAGGTTTAGGAGATGGTTCTCCTGCATGAGAGTTAGAAAACAAT
GGCAAAACAGAAATTGGAGGAGAGGTAAGGTCAGGATGTGATGCAAAAAAGTATACATTTTCTTGGAAAATGACATTTCT
AGATACTCGAATCCTACGGATGGTAGGATCATAACATAGAAAACCCTTTTGATGAGGAGAATATCCAAGAAAGGCACATT
CAACAGATAGTGCAGTGAGCTTGGTGCGTTCTCTTGGAGGAAGATGGACATAACACACACAACCAAAGATACGAAGATTT
GAGTAATTGGGTGGATGACCATATAACCGATTGAAAGGGGATTCATTACCTATTGATGGAGATGGCAATCGGTTGATAAG
ATGAACTGTAGTGGAGAGGGCTTCACACCAAAAACGTGATGGCACATGAGACTCCAGCAAAAGGGTGCGGACAACATCAA
GCAAATGGCGATTTTCTCTTTCCGCTACCCCATTTTGTTGTGGAGTTGAGGGGCATGACCTTTGGGATACAATGCCATTG
GATTGCAAGAAGTCCTGAAATGAGTGTGACATGTATTCTCCCCCATTATCAAAGCGAAAGATTTTTATTTTTGACGAAAA
TTGGGTCTGAACAAAGGCATGGAAAATTTGAAAGTGGAAAAGACTTCATCTTTTGATCGCATAAAATAGACCCAACTGAA
GCGACTATAATCATCAATAAAAGTTATGAAATATTTATAATGAGCATGAGATATAACCGGTGCCACCCCCCAAACATCAC
TGTCGATGATTTCAAAAGGTTGTGTTACATTAGACTGATGTGTTGGAAAAGGCAGAATTTTACTTTTACCAAGTTTACAA
GGAATACAATCAAAGTGAACAGCATTGAGAGATGAATTGTGTTTATTTCCAAGATAATTAGATTTGAGCAAGTCATGAAG
TACATTTGTGTTTGGATGTCCAAGACGCTTATGCCACACTTGGTAATCAACAATAGCAGAATTACAAGAAACTAAAGGCA
AAGAAAGACTGGAAGGCAATGAGAATTGGATTGGGAAAAGGCGTCCAACTTTAGGCCCCTTCGCGATTATCTTCCCTGAG
TGTTGATCCTGCACAAGACAACCAGACTGTGAGAATTGTACTTGACAATCATTGTCAACTAATTGACCAACTAAAATGAG
ATTACTAGTGAGACCAGGAGAAACAAAAACATTGGTTAGAGATGGAGAAATATCACCAGTGGTTGTGATAGGCAAAGGAT
TTCCATCAGTGGTGTGTATCTTGAGGTCTCCAAGATATTTTTTGATATTAGTAAGAAATTGAGCATTGTTGGTCATGTGG
TTGGAAGCCCCCGAATCAAAATACCAAGGGGAAGAGGATTTACCTGAGAATCCTAAAGCAGAGAATGCTGAAATGATCAT
TTGTTGAACCATTTCAGGGGTCATAGTCGGAGCAGGATCAGGAGCTTGTTGCTGAACAGGTGTTGGATTTACTGAATTAT
TAGGAACAGATGAATCAACTGAGGCTGTAAAAGCTGTGACATTTCGCTTGGGTGGCCTTATGGGGCATTCTTTAATAATA
TGTCCATCCTTTTTGCAGTAGTTGCAGAATTTGTTCAGACAGTTAGAAGCATAATGTCCAAATTGCTTGCAACAGAAACA
TTGAATAGTACGCATGTCATGACTTTTTGGTTTTCCTCGGGCCACATATGCCACTGGAACAATAGCGGATTTGTGATCTT
CAATGATGGACTGTGTAAGGAGGCGTTGTTCTTCACGCAACAGAGCATTAAAACATGCATCCAGTGATGGTACAGGATTT
CTATGCATGAGGTTGGACCGAATACCTTCAAAATCAGATCTCAATTTCATAAGAAATTGATCACGTTTAGTAGTTTCATG
AACTGTTTGGACTGAATTGAGGCCTTCAGAAGGCAAGTCCGCATAAACTATATCAGTGTATTCAGCCCAAAGATTCATGA
ATTGAGAGTAAAAATCAGAGATGGAGAGACTATCCTGTTTAAAGGTAGCGATGTCGTGTTCAAGCTGAAACCTTCGAGCT
TCATTGTTCTGACTGTAGACTTTCTTCAAGTAATTCCACATTGTGGCTGCTGTCTTGTAAGGCCGAAGATTCAGGACAAT
GTTGGGATCGACAGAGCCTAGGATCCAGGCCATGACATGAGCATCTTTGACTGTCCATTTGGTGTGTTCAACCTTAGCTG
TGTCTTTGTCAGGGACGGGAGAGCTGCCGTCAACATGACCCCATAAGTCTTTTCCAGTGACAAAGATCTGGAATTGGAAT
GCCCAAGCTGAGTAGTTTTTGCCATTAAGGCGAACCAAGAGAACATCATACTTTTCGGTAGACATGGAACAAGGGATGGT
AATCTGGACTGGGAAAGAAATGACCAAGAAACAGAAAAAAAAACAAGGACTTGGAGAGAACTGGAACTTGGACGAGGCTG
AAAGAACAAGGAAAGAAGTGCAGACTAGGGTCTTGGATCGAAACCTAGGCTGATACCATGTTAAACTCAGAAAAGGTTAG
GCCAAAAACTGTTGCTCCTCATAGAGATTTCTCATATAAATACACTTTAATTACAATCTGTCAAGCTGATTTTCAGCCCA
ATAAATAGCTAAACTGCCATATACACAATTACAGCTAATTATCCTGATTTTCAGCCCAATAAAATAGCTAAACTGCCATA
TATACAATTACAGCTAATTATCCTAATTAAGAGAGTAATTGTTACAAATAAATGTGCAATCCCATACAATTTGCTGTGAC
ATTTAATTCCGTGCTGTGACATTTAATTCCGTTGACA





USDA Logo
Iowa State University Logo