SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RLC_Gmr434_Gm7-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr434
Description   INTACT
Chromosome   Gm07
Start Position   17327360
End Position   17331578
Sequence   TATCAGAGGATAATTTTCTTATCCAAATTGATTAAGAGCATGTGCTCTTAATAATATACAAGGTAATCTAAAAAAGGAAA
TTCCTAAACTAATGTTCATCATTATACCCACTGTCAATTCCTATAATTAAGGGTCAATGATTCCTGGTCATAAATACAAA
ATATGCAGCTAATCAAATCTCCTAATAATGGGATTTAAATCCTATCTATAAAAGGAAATAAAATATATAGTAAGATTCTG
ACACTACCCCTCAAGTTGGTGAGTGGATGTTATCCATATTCTCAACTTGCTAACAATAGATTGAAATGTAGAGCCACTTA
ATCCTTTTGTTAGAGCATCTGCTAGCTGATTTCTTGTGGATACAAATGGTGTACAAATTTTCCCATTATCCAACTTTTCC
TTTATGAAGTGTCTGTCTACTTCAACATGCTTGATCCTATCATGTTGCACCGGATTATGTGCAATGTTTATTGCTGACTT
GTTATCACATTATAGTTTCATAGGTCCATTCCACTCAATTTTTAGGTCATCTAGAATTATTTTCATCCATAGGAGTTCAC
AAATTCCTAAGGCCATAGCCTGAAATTCTGCTTCTGCACTTGACCTTGCAACAACGTTTTGTTTTTTGCTCCTCCAAGTT
ACTAAGTTTCCTCTAAGAAATGTGCAATATTTGGAGGTGGATCTTCTATCATCTATAGATCCAGCATAGTCAGCATCTTT
ATAGGCCTCCAAAGTCATTTCCTCCCTTTTTTTTTAAATAAAATTCCCTTTCAAGAGTACCTTTCAAGTACTGCAAAATG
CGATAAACAACTCAGATGATTTTCTTTGGGATTATGCATGAACTGATTTAGCACTCCCATTGCATAAGCTATGTCTGGCC
TGGTATGAGACAAATAGATTAATTTTCCAACTAGTTTTTGATAGGATTCTCTATCCTCAGTTGCATCTTCAACATATTCA
CTCGGTTTGTGATTTTGCTCAATAGGAGTTTCTACTGGTTTGCATCCCAATTTACCAGATTCAGATAATAAATTCAGCAC
ATATTTAGGTTGGGAGATGAAAATACCATGACGAGAATATGCCACTTCAAGGCCAAGAAAGTATTTTAATCTGCCTAACT
CTTTAATCTCAAAATCTCTTATCAAACACTCTTTTAGGATGTCTATTTCTGCTTGGCCATTCCCTATTACAACTATATCA
TCCACATAGACAATTAGTGCAGTAACTCCCCCTGAAGCTCAATACTTAATAAACAAAGTGTGATATCCTTGACTTTGTTT
ATACCTTATTGCCTTCATCATCGTAGCAAACCTGCCCAACCAGGCCCTAGGGGACTGTTTCAATCCATAGAGAGTCTTCC
TTAGCTTACAAACCTTTCCTTCCTCAGATTTAAACCCAGGTGGTACCTACATGCAAATTTCCTCTTCAAGGTTGCCATGT
AGGAAAGCATTCTTGACATCAAATTGTTGCAAACTCCGTCCATAGTTAGCTGCTAGAGATAACAATATTCTAATAGTGTT
CATTTTTGCAACAGGAGAAAAAGTCTCAAGGTAGTCAACCCAATATGTTTAAGTATACCTCTTAGCTACTAACATTGCCT
TATACCTTTTTAGTGTCCCATTTGCCTTATATTTAACAGTGAATACCCACTTACAGCCAACGAGTTTCTTTTCTTTAGGA
AGTTCTACTAACTCCTAATTTTCATTTTTTTCTAGTGCATCCATTTCAACTTTCATAGCTTCTCTCCACTCTTTGCTAAA
CACAATCCCATCAGTTTCAGTGAGTATATTCTGCTCTTTCAAGACAGTCTCATTAGTTTCAGTTTTAGGTATTAGTTTAG
AATCTAGAACTTGCACAGGTTGGACAATAGGTTTTGCCCTTCGTGTGTAAACTTGTAGTGGACAGGCAGCACTTGGAGTC
TATGTTCTGGATGTCTTTGGACTCAAAGCAAAGGCAGGGGGAGTGTATATAGAACTGGAAGAAATGTGTATAGGACTTGA
CTCAAGTATTTTGGATTTGCTTGGGGAGATGAATGAAATATTCTTGAACAAATCATCCTTATATTCCATGCATGAGTTCT
CCAATTGAAGATAAGGTTGGGAAAAGAAAGATTCAGTTTCAACAAAAGTGACATCAATAAACACAAAGAAATTATTTGTG
GTAGGATGATAACACTTATATCCCTTTTGGGTAGGGGAGTAACCAACAAATATGCATTTGATAGCTCGGGGATCAAGTTT
TCCTTGATGGGGAGAATGAATGTAAACAAAGGACACACACCAAAAGATTGTAGTAACAAGGTTATTTGAAGTTTTATAGC
ATGGGTAAAACTTGGAGAACAGTTGAATGGGACTGTTGTTTTGAAGAGTTTGAGAGAGTAAATGATTAACCAAGTAGGCA
GCAGTAAGGACAGCCTTCCCCCAATACTGTTTTGGAACATTTGTGTGGAATAAAGATGCTCGGGTAACAGCTAGAAGATG
CCCAATTTTCCGATTAGCCACCTCATTTTGTTGTGGGGTGTGGACACATGATTCATGAATAATTCCATGTTCATTGAAGA
AGGAAGACAATGTTTGGTCAAAATAATCTTTGGCATTGTCAGAACGGAATCATTTGATGGTTGTCCCAAACTGATTTCTT
ATTATTTGAAAAAAAAAATTGGAATATTTGACTACCTTCATTTTTTTGTTTCAAAAGATACACCCATGATATCCAAGTAC
AATCATCAATAAAAATGATAAACCAATGGACCCCCAATATATTTGGAATGTTGGATGGACCCTAAACATCACTATGTACC
AAGGAAAAAGGAATTGACATTCTTTTATTACTGATAGGAAAGCTAACATGTTTGTGTTTAGCAAATTCACAATCATAACA
ATGAAACACTCCTATGTCTAGTCCTTGAAACAAGCTAGGAAACATTCTTTATTGTGGGAAGGAAGTGACTCTGACAGCAA
AGACAATGGGACTCTTAATGCTACATGTCCCACAAGCTTCCTCAAGAAGGTAAAGTCCATTTTACTCCCTAGCAAGTCCA
ATCATTTTCTCCATTCCCTAATCTTGAAATTTGCAAAGTGTGGGAGAGAATGTCGCTAAACATTGTAAATCTGTTGTAAG
TTTATGAATATAAAGCAGTTTGGCAAATAATTTAGGCACATGTAAAACATCTTTCAAAATTAAATCTTGACTTAGGAGAA
TGCCTCCCTTTCCAGCAACTTTAATAAATGTGTCATCTGCAGTTTTAATTTTTTTATTGCTAGGACAAGGTTTATATGAG
ATAAATTTAGTAGAGGAATAGGTCATGTGATCCGCAGCTCCATAATCAACAACCCATGCCCCTTGTGTAGTAGATTGGAA
GTACTTGAGAATGCTAAGGAAGAATTACATGTGTTTGTGGGTTTGACTAAAGTCTCTAGGACTTCTCTCAATTTTTTATT
TCTTCTATATTATAATCTGTAAGGGGTCTGGAAGGTTTGTCTGTTGCTGCAGCATCATCACTAACTCCAGCCAAAGATTT
TGCAAATTCTAGGCATATTCACTAACGGATCAGTCTCCTTGTTTGGTAGTCGCAATCTTCATCTTTATTTCATAAATTTC
AACAGCATCACCAACCTTGGAATAGTTTTGTTTACAATTATCCCACACATCCTTGGCAGTCTTCATGAACATGCAAGCAT
CACTCACCTCTAGCACCATGGAATTCCACAGCCATGACATCACTATTGCATCTGTTTCATCCTATGCACCAAAGGTACTA
TTTGTGGATTTTGGGCCATTGAGACGAAGGTTGGTTGAATATTTTGTAGCTCAACAGTGCTGGCCGGTATTTTCGGCATG
GGCCGATAAAAGGGAGGGGAAGAAAAAAAAAGGCAATGTAGGCCACATAACGGAAGAAAAAAAAAACGTGTGATAGTGCA
AGCCACGAGTTTACACAGGCTCCCACAGATTTTGGAGCATTGATACCATGTCAGAGGATAATTTTCTGATTCATGTTGAT
ATAAGAGCATGTGCTCTAAAATAGAATGCAAGTTAATCATAAAAAGGAAACTCCTAAACTAATGTTCATCATTGTATCCA
TTGTTAATTCCTATGATTAAGGGTCAATGATTCCTAATCATAAATACAAAATATGCCGCTAATCAAATCTCCTAATAATG
GGATTTAAATCCAATCTATAAAAGGAATTGACCCTTAATTATATAGTGAGATTCTAACA





USDA Logo
Iowa State University Logo