SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr432_Gm13-2
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr432
Description   SOLO
Chromosome   Gm13
Start Position   25342515
End Position   25342756
Sequence   TGTAAATTATCAGAAATATTCTCGTTGTCATTCACCTTGATTTCCTCAGAATATATACAACGTACATGCCTAATAAAAAG
CTTAACCGAAGGTTACAAATTAGGAATCAATATCCCAAAATATACGCTTAATAGAAGCCTATAAAATAGGAAGCAATATC
CCAAATTATATGCTTAATAGAAGGCTATAAAATAGGAAACTATTTATCTACGTTGACTAATATATTTATAATATATTTAA
CA





USDA Logo
Iowa State University Logo