SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr41_Scaffold60-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr41
Description   SOLO
Chromosome   unanchored
Unanchored Scaffold   60
Start Position   58410
End Position   58817
Sequence   TGTTGGTTAAAGTTGAAAATCGAGATAATACTGGATAAATCTGAAGTCGTGTATAACACATTCAGATTGAATCAAATTTC
GGGGTTCAACCAAAATTGTTCAATCGAATAAAATTGGAAAATTATAATTCAAGAGTTTTGTTTTGGTCTTGTATGTTTTG
TCACCCGTTATGCTTTCTGAACCAGAATGATTATTTATGATCAAAGAACAAGTGGTTTTTGGCAGTTGATGGAAGTTTTT
TCTTTTTTAAAAACTGCCGTTAATGGAAGTTTTAGTAACTTCCATGTAACTTCCAACCGTTGATGGAAGTTTTAGTAACT
TCCATGTAACTTCCAAAATTTGCCTAAACTGAACATCTCGTTATTACATTAAAACAAGCGTGGACTATTAGAAAATACAC
TTTCAACA





USDA Logo
Iowa State University Logo