SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RLC_Gmr374_Gm12-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr374
Description   INTACT
Chromosome   Gm12
Start Position   11391068
End Position   11395719
Sequence   TGTTGGAGTATGAATTCATCAAAAGAAAAATCAAGCACATACACTTTCCCAAGAACGAGAGAGAAAGGGAAAAACAGTTA
CAACGAAAATTATTTCTGTTAGCACATAGCTAATACTCAATCAATAGTTAGCTTATTTATTCTATTGAATTTTAACACAC
CCCCTTAAGCTAGTTTCCTGCTATCAACAATATTCAGCATGTTTCTCTGTTTCTTGAAGGTTTCAAATTTCAAGGACTTG
GTAAATATATCTGCAAGCTGATCTTCTGATCTGTAGAACTTCAACTTGAATTTTCCCTTCGCAACTTGGTCTCTTATGAA
ATGAAATTTGGTTTCAATGTGCTTTGATCTTCCATGTGCAATTGGATGTTTGGCTAACTTGATTGTAGATTTGTTATCTA
CATATAGCACAAATGGAACTTCTTCTTTGATCTTCAGTTCCTGCATCAAAGTATCAAGCCACACTGCTTGACAAGCTCCC
ATTGCAGCAGCAATGTATTCAGAGCTTCGCACGATGAAAGTGCAACCACAGATTCCTTCTTGGAGCTCCAAGAAATTGGT
GTTGAATCAATTAGAAAAACAAACCTAGCAGTGCTCTTCCTATCACTTTTGTCTCCACACCAATCAGCATTTGTATAGCC
ATATAGATGTCTTGTATTTTCACTATGGTTAATGGGCATCAAAATTCCATAACGAATTGTTCCTTTCACATATCTCAATA
TTCGTTTTGCTGCATTGAGATGTGATACTCTAGGCCTGTCCATAACTCTGCTAATCAGACCAACACTGAAAACCAGATCA
GGTCTGGTGTTGCAAAGATATCTCAATGCCTCAACAATCCTTCTAAACTCAGCAGCATCTACTAAGTCCTCTTCACTATC
TCTATCGAGCCACAATCCAGCTTTTGCAGGTGTTTCAACACTGTTACAGTGTTGCATATTGAATCTATGCAGAATATCAA
TAGCATATTTTTGCTGTGTGAGAACAATTCCTTCACTACACTTCTTGAATTCAATTCCAAGGAAATATGACAACTCACCC
AGGTCAGTCATGTCAAACTCATCCATTAGATTTTTCTTAAATTCATTCACTTTTGCTTCATTATTTCCTGTCAATAACAG
ATCACCAACATAAAGGCATAGCATAATAATGTCTTCACCCCCTGACTTCACATACACTCCATGCTCAGACCTACATTTCA
CAAAACCCAAATTGGTCAAGCTCTTATCTATTTTCATGTTCCAAGCACGTGGTGCTTGTTTCAACCCATATAGAGCCTTC
CTCAATTTGAACACCTTGCTCTCACTGCCTTTCACTACAAACCCAGGTGGTTGATCAATGTACACTTCTTCTTGTAAATC
ACCATCCAAAAATTCTGATTTTACATCAAGTTGATGTAGTTTCCACCCTCTCAAACTTGCATGTGCCACCACCACTCTCA
TTGTCTCTAATCTGGCCACAGGTGCAAATACTTCTTCATAGTCAATGCCTTGCCTTTGGAGAAATCCCCTTGCTACTAAC
CTCTCCTTATACCTCACCACTTCTCCTTTGGGATTTACTTTCACCTTATACACCCACTTCACTCCAATGGCTTTCTTATT
CTTTGGTAGTTCCACTAACTCCCAAGTATTATTCTTTTCTATGGAATTAAGCTCTTCATTCATAGCTTTAATCCATTTCT
TATTCTACATTGTTTCTTCCACTGTGAGTGGCTCAGATTCAGCTAGTAGTGCAAAATGCACTATCTCACCTTCATCATTA
ATTGCACCATCATTCAACAATTCAAAATCATTTAATCTTTGAGGGACTTGTCTCTGTCTCAAAGATCTTCTTGGCCCCTC
AACACTGCCTTCTCCAGTTTCATTTTCTTGCACAGTCACAGTGTCACTGTCTTCAAGTTGCAATTCAACTTGATTCTGTT
TTTCTATCTCTGGTGTGACATTCCACTCCCAATCCTTGCTTTCATCCACCACTACATCCCTGCTTATCACTATCTTGTTA
TTCATTGGATTCAACAATTTATAACCTCCAGTTGAGTGATATCCAATCAATATCATCATTTCTCCTTTATCATCAAGTTT
AGTTCTCAGTTGGTAAGGTACATGTCTATAACAAATAGATCCAAACACTCTGAGGTGAGACACACTTGGTTTCACTCCTG
TCCAAGCTTCCTCAGGTGTTATATTTTCCAATTTCCTAGTTGGGCTTCTGTTCAAGATGTATGCAGTAGTGTTCACAGCT
TCTCCCCACAAATATTTTGGTAGTTTCTTGCTCTTTAACATGCTCCTCACCATGTTCAACAAAGTTATATTCTTCCTCTC
AGCTACTCCATTATGTTGAGGAGTGTATGGAGGTGTTACTTCATGTGTGATGCCTTCTTTCTCACAAAATTCAGCAAACT
CAGCAGATACATATTCACCTCCACCATCCGTTCTTAATATCTCTAAATTCTTTCCACACTGTTTCTCCACTGAAACTTTG
AATTTCTTGAATACTTCAATCACATCACTTTTCCTCTTAATCAAGTAAATCCAAAGTTTTCTACTAAACTCATCTATAAA
TGTAACAAAGTATTCGTTACCTCCAGGAGTCATATGCTGAATTGGTCCACATACATCAGAAAAAACAACTTGCAGCTTCC
TCTTGGATCTTGTGGATACATTTGGTTGAATGAGTTTTTGGACATCTTGCTTTTTATACATTCTCCACATACATCATTTG
GCACCTTGATATGAGGAATTCCTTTCACTATTCCCTTACTCTGTAACCTATTCAGATCAGTGAAGTTTAAGTGACTATAA
CGAAAATGCCATAGCCATTCTTCCTTGTCAATTGTTGATGCTAAACACTGTTGCACTAGAACATCTAGCTTAGCTTTAAA
TGTTCTATTCTTTGACAAATTTGCTTTAATCAACAATCTCCTCTCACTGTCATACACCTTCATGGCACAATCCTCCAACA
CCATCTTGTACCCTTTCTCCAGTAGTTGTCCAATGCTTAGAAGATTGCTCTTCATTCCTGGAACATACAACACTCCAGAA
ATAAAGCATTTAGATCCATCTCTCTTCCTGATCATCACCTTTCCTACACCTTCAACCTTCATAGTCCTGTCATCAGCAAA
CCTCACCCTGCTTTTGACAGTGAAATTTATCTCAACAAACCATTCCTTTTTTCCTGACATGTGTGTTGAACACCCAATGT
CAAGGAACCAGTTATCACCATGATCACTCGCATCCTTCACAGTCACCATATATAACACTTCTTCTATATCTACTTTCTCC
TTTCTCACTTCTTCCACTCCATCATCACCAATTTCCTCCTTTACTGCCATTAACAAAATTTCCTCCTTCTCATCTTCTTC
TTGAGCCAATCTTGCATCAGTGTGGCTTGGATTACTATAGCATTCATCAGCAAAATGACCGTATTTCTCACAATTATAGC
ATTGAATGTGACTCTTATCAGTTTTTCATCCTCCTTTTCCACCTCTTCCTCTACCACCTCTTCCACCTCTTCTTCTATAA
TTCTCACTGCTATTGTTCTTTTGTTCACTATTGTAATTATTACTAGAGTTTCCTCTACCAGAGTTTGAGTTACAATTGTT
ACCTCTGCCTTTTCCTCCTCTGTAATTGTTTCTACTTCTGCCACGTCCTCCTTGATTGTCATGACTTCTGTTTCCACTTT
CTGCCATGAGTGCTTGTTCAGTGCTAGGCTTCACAAACTTCCTCTCATTCATTCGTTGTTCATGTGCTTCAAGTGATCCT
TGAAGTTCCTCCAATTTTAGTGTTGATAGATCCTTCGATTCCTCAATCGCTACCGTGACATGATCAAATCACGAATGCAC
CGATTGTAATATCTTCTCAACAATCTTCTCATCAGACAGAGTTTCACCACTCGATTGCATTTGATTTGTCATGGTTTGAA
CACGAGTGAAATAGGTAGCAATTGTCTCACTCTCTTCCATGCCTAGCCATTCATACTGTCGCCTTGGAGTTTGAAGTCGT
ACTTTCTTCAATTTCTGATCACCAGCGTAGGAGCTCGCGAGAACATCCCACGCCGCTTTGCTCGTCTCCGATCTCACAAT
TTTCTCAAAAATTGCTTGATTCACACACTAATGCAGAATGCACAAGCCTTTGCAATCCTTCTTCTTCGCATCTCTATATA
TCGCTTGTTGCGCAGCGATTGGATTCGCCGGCAACGGATCAAGTCCGTTCACCACCAGATCCCACACATCTTGATAACTG
AGGATCGCCTTCATCTTCATACTCCATTGATCGTAATTTCTCCCATCAAGAACCGGAAAGTTCGCCGGAAAGTTTGCGTT
CATCGTTGCCATTGATAAGGTTCCTCACCGCCTCTCGTGTTTTCACTCGCTTACCGTCTCTCGTGTTTAGGTTTCACTCA
CCTCACTTTCAATCGATGATCACACTTCAACAACCTGCTCTGGATACCATTTGTTGGAGTATGAATTCATCAAAAGAAAA
ATCAAGCACATACACTTTTCCAAGAACGAGACAGAGAAAGGGGAAAACAGTTACAACGGAAATTATTTCTGTTAGCACAT
AGCTAATACTCAATCAATAACTAGCTTATTTATTCTATTGAATTTTAACACACCCCCTTAAGCTAGTTTCCTGCTATCAA
CAATATTCAGCA





USDA Logo
Iowa State University Logo