SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr373_Gm3-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr373
Description   INTACT
Chromosome   Gm03
Start Position   31290387
End Position   31296785
Sequence   TGTTAGTGCTTGTGTCAATTGCACTATCACCCAGCACACCAAGCTTCACCTTGAAGATAGAAGAAAAGAGATGCTGAACG
AGAGAGAGCTATTTTATTCAAAAGGAAAAATTACACACTTAAAAATAACCTACACACTTATGTGGCCTTTATATCTCTCA
ATTCTATCTACATTACAACTTAACAGAAAAATAACAGAATGTTAACCAACTAACTCCTAACTACCACTAAACAAGGTTTG
AATTGACTCCAAGCTTCAACACCCTCCCTTAATTCAGATCCTTCAAGTTGCTGACCAGCTTACCACAAATTTGCTTGAAC
CTTGAAACTGGAACTAGCTTAGTCATTAGGTCTGCTAGTTGCCCTTCCGCTTGACAGTACTCCACAACTACATTGCCCTT
CGAAACTTGCTCTCTAATATAATGGAACCTCAGTTCAATATGCTTGCTTCTGCCATGCAAGGTTGGATGCTTGGCCAGAT
TAATGGCAGACTTGTTGTCAATCATCAAGCACACAAATTTCCTCTCCCTCAACTTCAATTCTTCTAGTAAATTCATCATC
CAAACTGCCTGACAAGCACCAAGTGATGCTGCCACATACTCAGCTTCACAAGTGGATAAGGCTACCACTTCTTGTTTTCT
AGAGCTCCAAGCCACTGGTGCGCCATAGTACATAAACAAATATCCACCAGTGCTCTTCTTCTGCTCTGGATCTCTCTTCC
AATCTGAGTCTGTGTAACCAAGCAAGTCTGATTTTTCTGATCCTGCTTCGAAAGGAAATAACACCCCACTATCAATTGTT
CCCTTCACAAACCTCAACAACCTTTTGGCAACTTGCATGTGTGACATTTTTGGTTCCCTCATAAACCTGTTGATTAGGCT
TACTGCAAAACAAATATCAGGTCTGCTATTGCACAAGTATCTCAAGGATCCAATTAGCTTCCTGAATTCTATTGCATCAA
CCAGCTCTTCCTCTGGGTCATTTTCCAGCTTGAGTCCAGCTTCAGCTGGTGTTGAAACAAAATTACAATTCATCATGCCA
AACCTTTTGAGGATCTCTTGTGCATACCTGCTTTGGTGCATAAACACCCCCTTCTGAACTTGATTAATCTCTAATCCAAG
GAAGTGTGATAACTTCCCTAGATCTGTCATTTCAAACTCAGTTATCATGAACTGTTTGAACCTTTGAATTTCCTCTTCAC
TGCTGCCAATCACAAGCAGATTAGATCATCTACATAGAGGCAGATTAGCAAAAGATTTGTTGAGCAATTTGCTCTCACAT
ACACACCATGTTCACTCTTGCACTTGCTGAATTTTTGTTTGGCTAGAACTCCATCAATCCTCAAGTTCCAGGCCCTTGGT
GATTACTTCAAGCCATATAGTGCCTTTCTGAGCAGATACACTTTCTCTTCTTGCTTTTCCTTTTCAAAACCTGGTGGTTG
TAGAGTATACACTTCTTCCTCCAACTATCCATTCAAGAAAGTAGATTTTACATCCATCTGGTACATTGGCCAACCTCTGT
TGCAGGCAGTAGCCACAATCATTCTGATTGTCTTTAGCCTAGCTACTGGAGCAAAAACTTCAGTATAGTTGATCCCTTTT
CTCTACAGAAATCCTTTTGCCACCAGTCTAGCCTTGTATTTGGCTATTTCTCCATTTGGCTTGTATTTTACCTTGTACAC
CCACTTCACCCCTATGGCCTTCTTTCCCTTTGGAAGCTTGACTAACTCCCAAGTCCCATTCTTTTCAATTGACTGCAACT
CTTCTTTCATTGCTTCTATCCATTTCCTTTCTTTGACAGCTTGAGCAAAGGATATGGGCTCTACATCAACAAATAGTGCA
ATGTGCACTTCTTCACTGGGTAAGAGTTCTTCTTCATCAGTCACCCTATCATCTGAGTATACCTCATATTGTTGGAGTCT
TGATGGATGGACCCTGGTTCTTTTGACCCTCCTGTGGGCTACCTCTTCTAGGTTCTGACTATCCTGATCCGATATGTCAT
GATTCACATCCTCATGCCCTTTAGCTGGTTTAGAGGCAGACTCATCCAGATCAAAATTGAGATCCTGCTGCCTAGGATTA
GTTTTTACAGTTATGTTTTCCAAATTCAGGCTTCTATACTCATCAAAGATTACATCACTACTGATCACTACCTTCCTTGA
GTTGCAGTCATAAAGCCTGTACCCTTCAATGGTATGGTAGCCCAACATAATCATTTGCTCACCCTTCTTGTCTAGTTTTC
TTCTCAACTGGTCTGGGACATGCCTGAAGCATAAACACCCAAACACCCTTAGATGTTTAATATCTGGCTTGTTTCCACTC
CAGATTTCTTCTGGAGTCACATCCTCATGCTTCTTTGTTGGACTTCTGTTCAACAAATACACTGCTGTTGATACTGCCTC
ACCCCAAAATTCCTTTGGCAGATGAAAGTTCCTTAGCATACACATAGTCATGTTGACTAGAGTTCTATTGAACCTCTTAG
CTACACCATTATGCTGTGGTGTGTTGGGAGGTGTAATCTCATGTATAATGCCTTCATTTTCATAGAATTTCCCAAACTCA
TGTGATGTGTATTCACCTCCACCATCTGATCTCAGCTTCAATATTTTGTTCCCACTTTGGGTTTCACTCATTGCCTTGAG
CCTTTTGAAGGTGAGGAACACTTCACTCTTTCTGTTCAGCAAGTAAATCCATGCTTTCCTTGAATAATCATCTATGAAAG
ACACAAAATAAGAGCTACCTCTTAGAGATGCTTTCTCAAAGGGGCCACACACATAAGTGTGAACTAGGTTCAGGACTACT
GAAGTTCTAGTAGCAATTTCAGCTTTATAAGACTTCCTTGGTTGCTTAGCCTCACAGTAGCTGTCACACACTGTACCTGG
TTGTTGTATGCTGTCAATTCCAGTAACCACTCTATTATTGCCCATCATTCTTAGCCTTTTAAAATTCAAGTGACCATACC
TCATGTGACAAAGCCAACTTTTGGATTCTTTAGTAGCTGAGAGACACTTCTGATCCTGTTGGCTCTGGATTTCAATCTTG
AAGGTCCTGTTGCTTGACACAGGTGCCTTGATGATCATCATGCCCCTCTGATCATCGATTTTCATGTGCTGGTCCTCAAG
CATTGTTTTGTATCCCTTTTCAAGCATCTGTCACAGACTTAACAGATTGCTGTGCATATTAGGTACATATAGAACTTCAC
TTATGACGAACCTCTTTCCGTCCTATCTATGAATCAATACCCTTCCAAGCCCCTCTGCTTTGACAGTGCTATTGTCTGCA
AACCTCACATTCTTCTTTACAGACTCATCTAGATCAACCAACCAATCCTTCCTCCCAGTCTTGTGGTTTGAACAACCTTT
ATCCAGGTACCATTCACTGTTGGTGGCCTTATCTGAGTCATTTGTCACCATCAAGAGGATTGGATCCTCTTCTGACTCAC
TTTCTTGAGCCAACTGTGCTTGATCATCTCTTCCCTTCTGTTGCTTCCGAGCCTTGCGCTGAGTTGCAAAATGGCCCCAC
TTCCTGCAATACCAGCATTGCACTTGCTTTCTTTTGGTGTTACCATTCTTACCATTGTGAGGCAAGCCCCTCTGCCTGGA
TTGTGACCCACCATCATCGCGGTTAGCTTCATCAGCACTTGAGTCATCAGTGCTATCATCTCTTGCTCCTTTCAATTTGT
GGCTTTTCTGTTTGATCTTCACTTTACCACTGCCTGGCCCAGGCTTGTATTTTCTCCCACTCTGGGTGAACAAGGCCTAT
TCAGATGGCCTATCTATTTCCCTTTCTTTAATTCTTTGCTCATGTGCCTCTAGAGAACATTGAAGCTCATCCAATTTCAT
CTCTGTGAAGTCCTTAGATTCTTCTATTGCAACAACCACATAATCGAATCTTGAACTCAAGGTCCTTAAAACCTTTTCTA
CAAGATCTTGATCCTTTATATTTTCACCACAAGCCATCATTTGGTTCAACAACCCCTACACCCGATTAAGATATTCTGCT
ACACCTTCTTTCTCCTTCATCTGCAATAGCTCGAATTGTCTCTTCAATGTTTGCATCTTGACCCTCTTCAATCTTTCTGA
CCCAACATACACCTTTGCAAGGATATCCCAAGCTTGCTTGGCTGATGTAGCCGAAACAATCTTGGCAAATTTTTGAGGGT
CCATACACTGGTGGATGAGGAAAATAGCCTTATAATCCAACTTCTTGGATTCTCTGAACATTCTTTTCTGTGCTTCGCCT
GCATCTTTTTCAAGCTCTTGAAGTCCCGCCATAATGATGTCAAGAACATCCTGCATCCCGAAGATGACCTTCATTTGAAT
GCACCATGCATCATAATTCTTCCCGTCAAGAACCGGTAGGTGCACCAAAGGCCCGTTCCCATTCATCATTGCACTGCCGA
GACCCACACTGGAACCATGCAAGACCTTCCCAGGATTGTTAACAAACAAAAGCTCTTGATACCACTGTTAGTGCCTGTGT
CAATTGCACTATCACCCAAAACACCAAGCTTGGCCTTGAAGATAAAAGAAAAGAGATGCTGAATGAGAGAGAGCTATTTT
ATTCAAAAGGAAAAATTACACACTTAAAAATAACCTACACACTTATGTGGCCTTTATATCTCACAGTTCTATCTACATTA
CAGCTTAATAGAAAAATAACAGAATGTTAACCAACTAACTCCTAACTACCACTAAACAAGGTCTAAATTGACTCCAAGCT
TCAACA





USDA Logo
Iowa State University Logo