SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RLC_Gmr37_Scaffold66-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr37
Description   SOLO
Chromosome   unanchored
Unanchored Scaffold   66
Start Position   139963
End Position   141491
Sequence   TGTGGAAGCAATGTCTTCCAAGGTTATTTTGATGATTCCAAAGAATCAAGAGTCAAGCAAAATTCAAGGATTCAAGAATC
AAGATTCAAGTTTTAAGAATCAAGATTCAAGAATAATCAAGATCAAGATTCAAGACTCAAGATTCAAGAAACAAGGGAAG
ACTCAATCAAGATAAGTACTAAAAACGTTTTCCAAAACATTGAGTAGCACAAGAAGTTTTCACAAAATCATTACCAAAGA
GTTTTACTCTCTCGTAATCGATTACCAGTGTTTTTAAAACGTTAGATTTCAAATTTCAAGAGTCACAACTTGTGTTTAAA
CTTGTGTAATCAATTACACAATACTTGTAATCGATTACAAGTGTTTCTAAATGTTTTAATTTTCAAAATTCAAAATAAAG
AGTCACATTTATTGATGTGTAATCGATTACACCTTAATGGTAATCGATTACCAGTGATTGATTTCGAAAAATACATTTCC
AAAAGTCACAATTCTTCAAGTGACTTGTTTCTAAAAATTCTTTCAAAAGTCACAACTTTTTAAGTGACTAGTTTTTAAAG
AAATTGCCAAGAGTCACAAGCTTTCACTTGAGTTATCAAGAGATTATAAATATGTGGCCATGGCATGAATTTTAATAATC
AATAATCTATCTTTCAATCTTCTTTCAACATCATTCAATATCTTTCAACTCTTTCTACAAAATTTTCTGATTCATCTTCT
CTTCATCTTTCTAAAAGTTTTTGTTCAACACTTTCTCTTTCAAGAAAAGTTCTTTGATAAAAAACTTGTGTTATTCATCT
TTTTCATTCTCTTCTCCCTTTGCCAAAAGAACGAAGGACTAACCGCCTGAATTCTTTTGTGTCTCTCTTCTCCCGTACAA
AAGATTCAAAAGACTAACCACCTGAGAATTCTTTTGATTCTTACCTTCCCCTTAAGCAAAAGATTTCAAAGGACTAACCG
CCTGAGATATCTTTTGTTACCCCTTACAAAGATTCAAAGGACTAACCTCCTGAGAATTCTTTGTCCCAACACATTGGAGG
GTACATCCTTTGTGGTACAAGTAGAGGGTACATCTACTTGGGGATTGTTATGCTGAGAACAAGAGAGGGTACATCTCTTG
TGGATCAGTTCAAGTGGAGGGTACATCCACTTGGTTATTCAAAGAGAATAAGGGAGGGTACATCCCTTGTGGATCTTTGG
CTTGTAAAGGATTTTACAAGGTTGAAAAGAAATCTCAAGAACCGCAGGTTGCTTGGGGACTGGATGTAGGCACGGTTTGT
GGCCGAATGAGTATAAATCTTGTGTTTGTCTTCTTCTTCCCTACACTCTTTAATTTCCGCTGTGTACTTTTAATTATCGC
TTTTACTTTTGGTTAAGTTTATATTTCTGTTCTTTACTTTCTTAACTTAGTAGTAAAAGCCTAATTAAATCTATTAACAT
TAAGAAGGATAAGTTTTTAATTAGTCAAGGCACATTAATAATTAATTCAACCCCCGCTCGTAATTATTCCGAGGCCACTT
GATCCAACA





USDA Logo
Iowa State University Logo