SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RLC_Gmr365_Gm5-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr365
Description   INTACT
Chromosome   Gm05
Start Position   27981111
End Position   27985829
Sequence   TGTTACAGATTTATCATCCAAAAGGTAAGAAACACAATGTGCAGCTTTTAGCCCATAAGGAAGAAGAATAATAATAAAAG
AAAAATGAGCACAACTTAGTGAAAATAGGGAGTTTTCACTTATTTTTCAGATGCAATAAATACAGAGTTCAAAATTCTCC
TTTTTGTAGCCAGATACAAGGCCCTATATATACACAGACAAACCCTAACTAACTAACTCTAACAGTTACAATAGAATAAC
AGAAATGCAGAGGGAATGCTTGCCATCTATACAAATCTCCACCTTGGCAAGTATCCTTTCTAGATGCAGACGCCTAAACC
TTCCAGCAGTCCACATTGAGTAATTCAAGACAATGCATGAACTTACTCTTTGGAACAGGCTTGGTGAACATATCCGCTGG
GTTGTCCTTGGTATCAACCTTCTGCACTTTTATCCTCTTTTCTGTTCGAATGAAGTGATAGCGGACGTCAATGTGCTTGG
TCCTCTCATGGTGGACGTTGTCTTTGGCCAAGCAAATTGCACTCAGGCTGTCACAGAAGATGATAGCCTTATTCTGTGGA
AACCCCAATTCAGAAATCAGACCCTTCAGCCAAATCCTTTCCTTCGCAGCCTCAGTCAAAGCCATGTACTCAGCTTCGGT
GGTTGACAGAGCAACTGTAGGCTAGAGTGTTGCTTTCCAACTGACAAGAGAGTTGCCAATTGTGAAAGCATACCCAGTCA
CAGACCGCCTCGCATCCAGATCAACGGCAAAGTCAGAATTTGAGTATCCCGTAAGTGAACAAGAGTTGTCAGCTCTGTAT
ACTAGTCTGATGTCAGACGTACCCTTAAGGTACCTGAGGATACGCTTCACAACAAGCCAATGCTCCTTTCTCGAATTGCT
TATAAATCTACTCACCACACCAACTGCTTGTGCTAGGTCCGGTCAAGTGCATACCATAGCATACATTAGACTACCCACAA
CACTAGCATAAGGAATACGAGCCATGTATTCCTTCTTTGCTTCCGATTGAGTAGAGTTGAGCTCGAACAGACGAATGGAT
GATGTCAGAGGTGTAGAGACAGGTTTTGGCGCGTTCATTCCAAACCTCTTCAGCACCTTCAAAATATACCCCTCCTGACA
TAAGAACAGCTTCCTTTGGTCTCGATCCCTCTTGATTTCCATGCCTAAAATCTTCTCAGCTGCTCCCAAATCCTTCATCT
CAAATTCACTGCCAAGTAGTGTCTTCAGCGTCTAGACCTCAGCCTTGTTTCTGGACGCAACTAGCATGTCATCCACATAC
AAAATGAGGTAGACATGGGAACCATCCTCCACCTTCTTATAATAGACGCATGAGTCATAAGGACTTCGAATGTACCCTTG
AGAAATGATGAAAGCATCAAACCTCTTGTACCATTGTCTTGGGGACTACTTCAAGCCATAGAGAGACTTCGTCAGCCTAC
ACACCCAAGTGTCCTTGCCAGACTCTATGAAACCTTCTGGCTGGTCCATGTAAATCTCTTCCTCCAAATGCCCATGGAGA
AAGGCAGTCTTGACATCAAGCTGCTCCAGTTCCATGTCCAATGCTGCTACTAGAGCAAGCAAGACCCTAATGGACGTGTG
TCTTACTACAGGAGAGAAGATCTCATTGTAGTCCACCCCCTCTTTCTGACTGTAGCCCTTAGCTACCACGCGAGCCTTAT
ACTTGACATCTACAAGTTTAGTTTGTCCAAGAATGGATGACATATCATTGGACGCACCAGGCCTGGAAACTCCACTATTG
GATGAACCAGCAGTGGACGACCCAAATTCAGACGACATTGAATTTGTACGTCCAACCTTCTTCTTGTAGATCCACTTGCA
TCCTACGGTCCTTCTGCCTTCAGGTAGCTTCACTAGATCCCATGTCTCGTTCTTCTGAAGGGACTCCATCTCCTCATTCA
TAGCCACAATCCACTTATCAGACTCAGCACAAGTGATTGCCTCTCGAATAGAGGTTGGCTCGAATGTGTCAACTTCCTCT
ACTACTTGTAATGCATAAGCCACCATGTCCTCGAAACCGTATCTTATGAGGGCTCTAATTTGCCTTTCAGACCTCTGAAT
TATAGAGTTTCCTGGTTAAGGAGCAGTCTGGCTGGACCCAGCACCAGACTCTTCATGAAATTGTTGTTGGACGCACTCCT
GGGGGTATCGTCTATCCCCACCGGACCCATCAGGTTGAGGTTGCTCCTGGAGTCTGCTGGTAGTGGTCTCCACCTCCACC
TGCTGAGTAACCTCCTGGACTTCTTTTTATCCTCTTTAGATTCTGCTGCAGTTTGTGGACGCAACAGAGATTTTTCATTA
AAAGTAACATCTCTGCTCAGAATCACCTTACCTTCAGACGGTGACCATATTCTGAATCCCTTGACTCCTCGTCCATAGCC
CACGAAAATACCCTTCTTGGCTCTAGGCTCCAACTTACCCTCCATCACATGATAGTAAGCTGGACATCCAAACACCTTCA
GTATTGCGTAGTCATCTGGTTGATCAGACCAGACCTCAACAGGGGTTTTGAATCCATTAACAGTGGGCAGAGATAGGTTC
ACCATATAGCAAGCAGTGTTAACTGCTTCAGCCCAGAAGTTGGCGTCCAGACGCGCATTAGACAACATGCACCTTGCTCT
CTCAAGCAGGGTTCTGTTCATCCTTTCAGCTACTCCATTCTGTTGAGGAGTATGACGAAAAATGTGTTGTCTAGCAATGC
CTTCCTCCTTGCATAAGTTATTAAACTCCTCAGAGCAGAATTCCAAGCCATTATCCGTTGGCAGACGCTTCACCCTTTTA
CCCGTTTGGTTCCGCATAAGCACCGTCCAATGCTTGAAGTTCTGGAAGGCTTCAAATTTCTGCTTCATCATGAATACCCA
AGTCTTCCTTGAGTAGTCATCAATGACAGACAAGAAATATCTAGCTCCTCCCAGAGATGGAACTTTCGAAGGCCCCCAAC
AATCAGCATGGACGAGGTCCAGGGTTGCCTTCGTTGTGTGTACTCCCTTTGGGAACTTGAGTCTGTGTTGCTTCCCATAC
ACACAACCCTCACAGAACTGAAGAGTTTCCATCTTGAGGTTGCCTAGCAAACCTTTCTTGCATAGAATTTCTATACCTCT
CTCACTCATATGGCCCAGACGCATGTGCCATAGAGAATTATCAAAGGCTTTAGATTGTGACACGAACGAGGAATTTCCTG
TCACAGTGGACCCTTGCAAGATATAAAGATCACCTTGCCTCGTTCCCTGCATTACTACAGACTTCCCCTTTTTTGACTTG
CATCACCCTTCCTTCAACACTACAGATGAACCCCTTTGCATCCAGCGCACCCACAGAAATGAGGTTTTTCTTCAGATCAG
GGACATGACGAACATTGGTCAATGTTCTCACCACACCATCATGCATCTTGATCTTTACAGACCCAATGCCAATGGTCTTG
CAGGGAGCATCATTGCCCATCAACACATTACCACCTGCCTTCTCCTCATAGTCATCTAGCCACTCTTTGTGTGGGCACAT
ATGAAAAGAACAGCCCGAGTCTAGAATCCACTGCTCAGAATGACGTTGCTGGTGTGAATCAGCAGCTAACACCAAACTTT
CGTCTAATGAATCATCTTGGACAATGGCAGCTGAAGAATTCTTGTTCCTTTTCTTGGGGTAGTCCTTCTTCCAGTGATCT
GACTCCTTGCAGTAATTGCATATGTCCCTAGGATCAATCTTGCCTTTCTTGAACTTCTTCTTTTGTTTGTCCTTCTGAGA
GGCTGTTAATCTAGAGGCAGACTCATCATCATTCCCAGACGCCTTGTGACGGAGCTCCCTTGAGAAGAGACTGGACTTCA
CTTCCTCGAGGATGATGCAGTCCTTTCCAACTGTCAGAGAACTCACAAAATTCTCAAATGAGGGAGGAAGAGAGGCTAAC
AGAATCATTGCAACGTCTTCATCTTCCATCTTCACGTCTATGTCGCGTAGTTCCATCAATATTGAATTAAGCTCATCCAA
ATGCTCCTTCAGAGATGCACCCTCCTTCATGCGAAGTCCGAAGAGTCGTTTCTTTAACAACAACTTGTTGCAGATGGACT
TCGTCATGTAGAGTTTCTCCAGCTTCAGCCACAACCCAACAACAGTTTGTTCTTCAGCCACCTTGTAGAGAACTTCATCT
GAGAGAGACAGAAGAATCAGCGAGTGAGCCTTTTCTTCTTGTTGCTCCAGAACGGATGCTTCTAGGTTGGAGGGTCTGCC
GGAGAGTGGTGCCCAGATGCCCTGTTCCTTCAATAGAGCTCGCATCTTGATTCACCACAAATTGAAATTGTTCTTCCCTG
TGAACTTCTCGATCTTGATTGTGTTGGCCATCTTTCAAGAATACTGGAAACTTGAAATAAGAAACTAAACACAATGATAG
AGCAACAAATGCGGAAGTCGGATCAGAGCAAGCTTTGATGCCAGTTTGTTACAGATTTATCATCCAAAAGGTAAGAAACA
CAATGTGCAACTTTTAGCCCACTAGGAAGAAGAAGAATAATAAAAGAAAAACGAGCACAACTTAGTGAAAATAGGGAGTT
TTCACTTATTTTTCATATGCAATGAATACAGAGTTCAAAATTCTCCTTTTTGCAGCCAGATACAAGGCCCTATATATACA
CAAACAGACCCTAACTAACTAACTCTAACAGTTACAACAAAATAACAGAAATGCAGAGGGAATGTTTGCCATCTCTACA





USDA Logo
Iowa State University Logo