SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr351_Gm6-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr351
Description   SOLO
Chromosome   Gm06
Start Position   6676380
End Position   6676629
Sequence   TGTTGGATAAAAATAATTCAAATAATTAATTAGCTAGTTCTATCATTAGTATTAGTATGTTTGTTAATGGTTATTATAAT
AGAATTAGTTGAAGAACTATATATAATAATACTGTGCAATACATAAAATAGGATGTGAATGTGAATTAGATTGTCATAAA
GAAAATTTCTCTTTCTCTATTTTCTTTCTCGCGTGATTGTTTCATGTTAGTGTGTGAAGGCATAACTGATAATTTCTCTC
GGTTCTAACA





USDA Logo
Iowa State University Logo