SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr35_Gm9-9
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr35
Description   SOLO
Chromosome   Gm09
Start Position   28532103
End Position   28532537
Sequence   TGTTGGCAATTTTCAATAAACCTTATACAATACCAAATGAACATTAAAACACATTACGTCAGATTATCAAGAGATTTTAA
GGAATACCTGGAACCATAGAGCTTGATTAACACGCAGCGGAATCTGGCAGTGGTTACGAACAATTGGTTTAATGACCTTC
CTCAACCAAATCACCTTCTTTCTTATGGGACCTTCGTTTTCTCTTCAGATGGGAAGAGGAGAAACTGTTTGTTGATTTGG
TATATTGGGAACCATAACCATCCCTTATGTTTTAAACCTATTAGGATTCCTATTATCCCTTAATGGGTCAAACTGGTTTC
CGCAGTCCATATCAATTTTTTGGCCGGGCTCACTTAAATAGATCACTTTATATTGAACCTTATAATATAACATGTAGCCC
ATATTAATTAATTAGAAATTATAAAATTCCTAACA





USDA Logo
Iowa State University Logo