SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr28_Scaffold97-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr28
Description   INTACT
Chromosome   unanchored
Unanchored Scaffold   97
Start Position   17547
End Position   20109
Sequence   TGTTGAAGATATACTTTTGTAACTGCATAATATTTTATTTTTCAGTTTTTAAAATAGGATTTAGTAAATAAGTTGATTTC
CTATATTTTAGGAGCAAGTCAGTTTTAATGGATTTGCCTAGTCAATAAGTGGTTCCTCTTATCTTTAAGGAGCAAGTTAG
TTTTAATATTCTGTTTTGCTAATATCTTGTTATCTAATTAGTTTATCTTTTGTTATTTATTGTATCACTGTTGAGAACAA
TTTGAATGAGAATAGAATAATTCTATTTCATACGTATTGTCTCTCTTCTCTCCTCTGTTTTTTTATAATTTCCTCCAGAA
AACCAACAATTGGTATCGAGAGCCTTATTCTTATGGGACTTCTACCATGGAAGGTGAAGCAAGTTTTTCCCACATAACTC
TTCCAATCTTTGATGGAGAGAATTATGATCTTTGGGAAGTGAAAATGCAATCCTACATGGAGTCTTTGGATTTATGGGAT
GCTGTGGAAGAGGATTATGAAATATTTCCGCTGCCTGAAAATCCCACCATGGCCCAAATTAAAAATCACAAGGAAAGAAA
GATGAAGAAGGCAAAGGCGAGATCATGTTTGTTCACTGGTGTTTCACAAATGATATTCATCAGAATCATGACTCTTAAAT
CACCCAAATCAATTTGGGATTATCTGAAAGAGGAATACGCTGGAGATGATAGAATACGAAGCATGCAAGTGCTGAATTTA
AGGAGAGAATTTGAGCTTCTAAGGATGGAAGATTCAGAGACAATCAAAGAATACTCAAACAAATTATTGGGTATTGCCAA
CAAGATAAAGTTGTTGGGAAGTGATTTTGCTGATTCGAGAATTGTAGAGAAAATTTTGGTAACGGTGCCGGAGAGGTATG
AAGCATCTATAGCTTCATTGGAGAACACAAAGGATTTGTCGAAAATCACATTGGCAGAAGTGCTACATGCCCTGCAAGCT
CAAGAGCAGCGAAGGTTGATGAGGCAAGATCGTGTTGTCGAAGGTGCTTTGCCCGCTAAACATCATGAAGTTGATGAAAG
CAAAAAGGATTTTTTCAAGAAGAATCAACCAACAAGCAGCGAAAATAATGCAAACAACCAAAACAAAGGTAAGGATAAAA
AGAAAAATTATCCACCTTGTCATCATTGTGGCAAAAAAGGTCATGCACCTTTCAGATGTTGGAGGAGACCAAATGCAATA
TGTAACAAGTGCAACCAGATAGGGCATGAAGTGGTGATCTGCGCCAACAAAAATCACCATGATGAGGGAGCTCAGATTGC
TAATCAAGAAGAAGAGGACCAATTGTTTGTGGCCACATGCTTCTTGAGTAGTGAATCAAGGGAAAGTTGGTTGATTGATA
GTGGTTGTACGAACCACATGACATATGATAAGACTTTATTCAAAGATTTGAAGCCAACTAATGTCTCAAAGGTCAGAATT
GGGAATGGTGGCTATATTCCAGTAAAAGGAAAAGGAACTGTTGTAATTTCAACGTGTTCAGGTATCAAATTAATATCAGA
TGTTCTTTATGTACCTAACATTGACCAAAACTTGTTAAGCGTAGGTCAATTGATTAAAAAGGGATTTAAAGTGTCCTTTG
AACATCAACATTGCTTAATCTATGACATTTTTGGCCGGGAAGTTCTAAGGGTTAAAATGAAAGGTAAAAGCTTTTCATTT
GATCCAGCAGAGGAGGAGCATACAACCTATTTCACTCAAGTCACACCCATGGAATTCAAGCACAAGAGACTCGATCATTG
CCATCTTGAAAGAATGCTAAACATGAAAAAAAAGGAAATATGCAAAAGAAAATTTGAAGAAGTTTCAAATGGAGGAATGC
AAATCTGCTAGCACACTAATGAATCAAAAGGAGAAGTTCAGAAAAGAAGAAGGTGTTGATAACATTGATGAAGGATATTA
TGGGAGCTTGATTGGATGTCTAATGTATCTCACTACAACAAGGCCAAACATTCTATTTGCTCAAAAGAACAAAACTGGAA
TTTTTGTTGACAATCAAGTAGTCATTGCTATTGCAAACAATCCTGTGTGTCATGGGAAGACTAAACATTTCAACATCAAG
TTCTATTATTTGATAAAGATGCAACAAAGTGGTGAAGTGAACTTAATTTATTGTAAGTATAAAGATCAACTGGCTGACAT
GTTTACAAAGTCACTACCTATCAACAAACTTGAACTCAAAGAATTGGAGTTTGCAGTTCCAAAAGCAAGGAGGAGTGTTG
AAGATATACTTTTGTAACTGCATAATATTTTATTTTTCAGTTTTTAAAATAGGATTTAGTAAATAAGTTGATTTCCTATA
TTTTAGGAGTAAGTCAGTTTTAATGGATTAGCCTAGTCAATAAGTGGTTCCTCTTATCTTTAAGGAGCAAGTTAGTTTTA
ATATTTTGTTTTGCTAATATCTTGTTATCTAATTAGTTTATCTTTTGTTATTTATTGTATCACTGCTGAGAACAATTTGA
ATGAGAATAGAATAATTCTATTTCATACGTATTGTCTCTCTTCTCTCCTCTTTTTTTTTATAATTTCCTCCAGAAAACCA
ACA





USDA Logo
Iowa State University Logo