SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr233_Gm6-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr233
Description   INTACT
Chromosome   Gm06
Start Position   45091459
End Position   45099197
Sequence   TGTTAGAATAATATGACTCATGTGAACCTAAACTTGATTTAATAAAATAAAGGGACTTACTGGCAAATACGGGAAGTTAA
TAAACTTCTAATAAACTTATGCGAAGTTAATAAACTTCTAATAACTAACTTGATGGAACTTGGTTAATAAAAGACAAAGG
GTTCCATCTCTGCCATAAGCGTTTTCCTCTAATTATCATCAAGAACACGAGAGGAAAATAAAAGAAGGAAAGAGATAGAT
TGGGACAAAGAAGATTGAAGGACTTATGTCTTTCATGGATCAAGGTAAGTTCTACTTATTTTCAAACTGTACGAGGGAAT
CATAGATTATAATATCCTTACAATATGTTATGGATTCATTGAACATAAATGTATGGAATCTATAACTAACATGTGGTATT
AGAGTCATAAGTTATTGAATTTATGATTCTCCATGAATGATGTTTCTTCCACACACTGAATCAATCTGATTCCAATTCAA
AAATTATTCAAACCATTTTGTTTTCCGTTGTGCATATTATAATTGTTTTCGAGTTTGAAATGCCCTGAATCCAATTTTTG
AATGTCTTGAATTGAAATTCAATATCTCTTTCTTACGCTAATTTCAATTCAAAATTGGATCAAGTAATTTGGATTAAATG
TATGATAGATATGCAATCACCAAAGTGGTCAAATCTTTATGTTTTGTTTAATTCCAAATTAGTGAAAATTTTATTTCAAT
TACTCATAGAATGGATGCTAAATTATACATTATTGGTTTATGGGTTAATTGAAGTTCATTATTATAAGACATTTATGGAT
CACCCAAAGGTTGATTAGTTGTTCTTATAATTTATGGATATGATTGTTGGTAGTATGTATGCATTATTAGTTTTATTTAT
ATATCCAAAGATAATAGTATTTCTAATTAGTGCATATGCCTTACCAAATAATGTTAAAATTATTAGCATCAGTATGTTTT
TTTTTTTTGTGTGTATTAGTGTATCACCCAAATGAGAACATTAGTATACATAGAATGTTTGTTTGTTGTTTGAATTTGTA
TTGTATTTATGACTCAAAGTATCAATGTTAAGCATGTGTTAATTGCAATATCCCTTCCTGTATCTTTGCATCCTCTTGGT
ATGTTTGTTCCGGTTTTTAATGGGTTAAATTTCTTTGATTGAAGCAAACAAGTCCAATTTAACTTAGGTGTGTTGGATCT
TGATTTGGCTCTTCAAGTTGAAAAAACCTGATGCTAGCAGCAATGAAGAGAAAACCCATTATAAGGCCTGGGAAAAGTCA
AACAAAATTTGTTTGATGCTTATGCTCATGAACATAGCTAATAACATTAAGTATGCTCTTCCCCAGACTGAAAGTGCAAA
AGAATTTATGAAATCTATGGAAGAGTGCTCCCAAACTGCTAATAAGTATGTTGCTGAGACATTAATGAGTACTTTAACCA
TCATGAAGTTTGATGGTTGTCGTATTATACATGAACATGTCATTGAGATGACAAATATTGCAGCAAAACTTAAGAAATCA
ATATATGGACTTAAACAGGCTTTCCGACAATGGTATTGTTCGGATCCCTATACTACTTGTTATTTTGGATGCGAAATCTA
ACCGGTAAGTGTACCGAGTCGTGCAAGTAATAATAAAACGGTAAGAATCGAGTATCAAACTCGGGGAATTAGTTTCATTT
GGTGAAATTTCATTCAATAAACAGGCATTTGTACAAAGAATCAATAATCATGAATCAAAGCAAGAGTGTATTCTATTCTA
ATGATTAATTACAACAAATATGAGCAAGTGGGTGTTAAAATAGATAATTAAAAGCGTTGGGTCCTCCTACTGAGTTACTT
GATGCAATTAAGGGCTTTTCTTTATTTAAAGATGTTCATGCGTTCTATGCTGGGGACAACACTCCCAAACATCGATGTCT
CGCATGCAAGGACTGATTCTAATTAATCCTCATTCTTGGATGTCTCGTCAAACTTAGCTTAACCGAACAACATTAGGCTC
ACAACATAATAAAACTAAATTACCGCACTCCGTGTCCAGACATATGATAACCTAGCTCATTCTATCCAGTTCTAAAGATG
CAATACATTTTTCAATGTTAAAGATCCTAACTTTACATACAAATGGGTGATCAAGCCACAAGCATGCAGTAATTAAGCAC
AGATAGAAACATTGAACACATAAAAATAACTTCAAATAGATAGGATAAGAATTTACATCAAATACCCAGCAGAATTCCCC
AACAAAGGGGTTTAGCCTTCCATCACAAGGCAACACCTTTCACAAGCAGGAAGAGGGTTTTCAGAGGAAATAACATATTA
CACAGTGGTGGGGATGTCTCCTCCACCTCTAGAAACCTAGAAATCACTCCTAAACCTAAGATTCTCCCAAAAGCTAAGGT
TTTTGCATCCTTGCTTTGTTTTGCGCCTTTGTTCTCTGTTTTTTGCACTCTATCCGCCAAGCTCTCAGCTCTGATCTCAT
TTCAGGCTTAAAAAGGGCTTTCTAACCTCAAAGGCATGCTTAACGCCATTTTTGCGCTTAGCGCAAGTAAGTGAATTTTG
GCTCAGCGAGCCAGGCACGCTAAGCGCCAGAAGAGACAGATGACTCGCTGGGCGAGCTGATGACGTTTTGAGCGCATGCT
TGCATGGCAGATTCCCTTCAAGATTCCTCTTACTCACTAAGCAAGCTAATGTATCGCTTAGCGGATGATACTCGCTAAGC
ACATGGTCCAAGCTTAGCGAGACAACATTTGTTGCACCTTCTAATTATTCTCCTTTTTACCTGAAATTGAAGTGAGATTT
ACATTAATTCCTTGCGGAAAGTATCTACTGAGCAAAAATTATACTAAACAAGAAAATATTTACAGTCCTACAAAAAGAAC
CATAAATTGGGAAAAGTATATACATTTTGGAAAACTTTTCTATACAAAAGTTAGTCGTAGATGACGACTAACAAACTCTC
CCAAATTTACAGTTTTGCTTGTCCTCAAGCAAAGAAAGAACAATTCACTTGTCCTCAAGTGATTAAATCATAGTGGTTAT
TCACAAAGGTGTTTGTTTCAAAGAATTCAATCACATGACATGAGTGGCATTCAATGTTTCAATCAACAGCTTCTCACAAG
GCATGCAGCTCTTAAAAGATATGAACATGATTATTAAGCAACACAACTAAAATAAGCTAATAAGTAAGACAGATATCAAG
GAAGGATCATCAACCAATGTCTCACGGTCACTGTTTCACTCAAGCACAACTGTTTTGGTTATTCATCAATCAACAACCAA
CACAAGTCTCAATCTTTGCAATTCATCTCTTGCCATACAGTCATAAACACACAAACTGAATCTGAAGGACTTTTCTAAGC
TTGTAATGAGGTCGGGCTACAAACAAATTATGGTTTTTCTAAGATGAAAAAGCTTAAGTTATAGGAGAGCATTCATCCAT
AGATAAACTCTTTTCATTATTATTTCCAGCTTCAATTACTTGCCTTTCAGCACTTAGCTTTATTAGATAACAACACACAC
TCAGTTTTATTTTTGATACTTACAGTTTTTTTTAACAGCAGCTTTTTACTTTATTGTGTGTGTTGTCATCTTCTTACCAT
TAGAAGTTGTCACCCAATAAACTCCCCCAAATTTGAGACAAATTTGCTTTGAACCATAATGCTCTCCTACAACCTAAGAC
AAGGTAGGTAGAGATATAATTTCATAGGCTCAAGGTTCAAATCAAGCAATCAGATTTTTAGCTTAATCATGGGTGCAAAG
GATATATCATTTCATTCACAAGGTAAGCTTTTTGGCTAAGTGGCAGTTTCAATCAATCATGGCCTTCATCCTCTTCACAT
TCATGCATTCATTCCATAATCAAATATTCATGCAAAAATCATTACTCAATACTAGTCGTTCCCTCACAATTAAAGATCAC
ACACTCACCGGGTTATGGCTAATGAGCACCTTCACAATCAATCTGTCAAACTAACTAACATTTCTAGTCATGATCCCAAT
CCATGTTTTTTCTCTTCTAATCGTTGCATGCTCATTCAAAGCATATGATCTACGCATTACACTTCACTCAATTCATGCAA
TTGATAATTTCAAACCATTCAACAAACACAGAATTTTTAAAATCAAATAACCAAACCACTGCATAAATATGGAAATGTAA
AATGTTCGACAAGCTTTAAAACAAGCTAAACATGCAAACTAAAAATGGAAATTAAAAACTGAAACAGAAATATAAACCCA
AATTATAAAATGTGCTAAAAGCAGAATAATAATAAAAGTGTTCAAGAGATAGGAAAATAGAATAAAAGTCCTGTCATGGG
TCCTGTGGTCCTGGAGAGGGGTCATCCTGGGCTGCTGCATAATCCATATATGTGGCCTCATCCTCCTCCTCAGACAGCTC
CAGCACATGTGCAGCCACCGGTGATGCCTGCGGAGAAGACAACTCTAGCCCATGTGTAGTCACCGGTGATGCCTGTAGAG
TCATCTTTGGAGTAGCCTCTATAGTGTTTTCCTGAGCAGCTAGATCGGTCTCCGGATCACCCTTTGGAATATCTGGTGTG
GCCTCTGGATAAGCATCTGGATCAGCCTCCTGAGCAACTGCCTTTGGCTCCGGCTGAGGCTCATGGGCTGCGGAGGCCTC
ACCTCCCCGGCAATGGCACCAAAAACTTGTTCGGATCCCTGTACTACTTGTTATTTTGGATGCGAAATCTAACCGGTAAG
TGTACCGAGTCGTGCAAGTAATAATAAAACGGTAAGAATCGAGTATCAAACTCAGGGAATTAGTTTCATTTGGTGAAATT
TCATTCAATAAACAGGCATTTGTACAAAGAATCAATAATCATGAATCAAAGCAAGAGTGTATTCTATTCTAATGATTAAT
TACAACAAATATGAGCAAGTGGGTGTTAAAATAGATAATTAAAAGCGTTGGGTCCTCCTACTGAGTTACTTGATGCAATT
AAGGGCTTTTCTCTATTTAAAGATGTTCATGCGTTCTATGCTGGGGACAACACTCCCAAACATCGATGTCTCGCATGCAA
GGACTAATTCTAATTAATCCTCATTCTCGGATGTCTCGTCAAACTTAGCTTAACCGAACAACATTAGGCTCACAACATAA
TAAAACTAAATCACCGCACTCCGTGTCCAGACATACGATAACCTGGCCCGTTCTATCCATTTCTAAGGATGTAGTACATT
TTCCAATGCTAAAGCTCCTAACTTTACATACAAATGGGTGATCAAGCCACAAGCATGCAGTGATTAAGAACAAATAGAAA
CATTGAACACATAAAAACAACTTCAAATAGATAGGGTAAGAATTTACATCAAATACACAGCAGAATTTCCCAACAAAGGG
GTTTAGCCTTCCATCACAAGGCATCACCTTTCACAAGCAGAAAGAGGGTTTTCAGAGGTGGTGGGGATGTCTCCTCCACC
TCTAGAAACCTAGAAATCACTCCTAAACCTAAGATCCTCCCAAAAGCTAAGGTTTTTGCTTCCTTGCTTTGTTTTGCGCC
TTTGTTCTCTGTTCTTCGCACTCTATCCGCCAAGCTCTCCACTCTGATCTCATTTCAGGCTTAAAAAGGACTTTCTGACC
TCGAAGGCGCTTAGCGCGAGTAAGTGAATTTTGGCTCAGTGAGCCAAGCGCTCTAAGCGCCAGAATAGACAGATGACTCG
CTGGGTGAGCCGATGACGCGCTGAGCGCGTGCTTGCGTGGCAGATGATACTCGCTAAGCGCATGGTCTAGGCTTAGCGAG
ACAACAACTGCTGCACCTTCCCATTATTCTCCTTTTTATCTGAAATTGAAGTGAGATTTACATTAATTTCATGCGGAAAG
TATCTATCGAGCAAAGATTAAACTAAACAAGAAAATATTTACAATCCTACAAAAAGAACCATAAATTGGGGAAAATATAT
ACATTTTGGAAAACTTTTCTATACAAAAGTTAGTCGTAGATGGCGACTAACAGGTATCTTAATTTCAATGATACTATTAC
GTCCTTTGGATTTAAGGATAACACTGTTGATCGGTGTATATATCTGAAGGTCAGTGGGAGCAAATTTATATTTCTTATTT
TGTATGTTGATGACACCTTGCTTGCTACTAATGATCTTGGTCTATTAAGTGAGACTAAGAAGTTTCTCTCTAAGAACTTT
GAAATGAAAGATATAGGTGAGGCAGACTATGTGATAGGAATTGAAATATTCCATGATAGATCACAAGAATTGTTAGGCTT
GTCTCAGAAATCATATATTAATAAAGTTTTAGAGAGATTCATAATGGATAAATGTTCAGCATCTCCCATTCCAACACAGA
AAGGAGACAAATTTAGTCTTATGCAATGTCCAAAGAATGATATGGAACGAAAATAGATGGAAAATATTCCTTATGCATTT
GCTGTTGGGAATCTGATATATGGTCAAACATGCACAAGGCCAGATATTATCTTTGTAGTTGGTATGCTTGGTAGATACCA
AAGTAATCCAGGATTGGATCATTGGAAAGCTGCAAAGAAAGTCTTAAGGTACTTGCAAGGAAAAAAGGATATCATGCTTA
CTTATAGGAGATTCAGTCATCTTGAGGTGATTGGATATACAGATTCAAACATGGAGGCTGAATTTGTGGCATGCTTTAAG
GCTACAGTTCATGCTAATTGGTTGCGGAATTTTATTTCAAGACTTGGAGTAGTTGATAGTATTTCCAAGCCGCTGAAAAT
TTGTTTTGATAATACCGTAGTTGTCTTCTTTTCTATAAAAAAAATGACAGATATTCTAAAGGTGCTAAGCATATGGAATT
GAAATGCTTTGTCGTTAAAGAAGAACTTTAGAAACATAGAGTGTCAATAGAACATATTAGCACTAATCTAATGATTGCTG
ACCCTTTATACCGCCCAAAGTATTTACTGGCCATGTAGTAAATATAGACATTATGTCTGCTAGTGAATGTTGAATGTTAT
TATTATTAATAAAGTCTATTTGACACTTTGAGCTCATTATTGTGTAAGTTTATGAAATTTATGTTTTCTACTTTATGTGT
ATATGCATGCAAATTATGATGTAGAAAATATATTATGTTTTTGTTAATGAAAGAATGACTTTTGTTTGGACCCATTATGA
ACTTGTGATTTTACAGTCATATTAAAGAGAAGGATAATATAGTAGTCCAGGGAAGATAATATGTTGATTAAATGACATGT
AACCTCCATGACTCATTATTTTTCATCTTTAATTATGATTAATGATGAAGCCAATTTTTTTAAAGTATTTTAATGTGCGT
TATGATTTATGTAATTATTAAATCATGAAGTGTTATGGCATCACAAGAGTCAAGTGAGAGAATGTTAGAATAATGTGATT
CATGTGAATTAAGGGCCTAAACTTTATTTAATAAAATAAAGGGACTTATTAGCAAATATGAGAAGTTAAAAACTTCTAAT
AAACTTATGGGAAGTTAATAAACTTCTTATAACTAACTTGATGGAAGTTGGTTAATAAAAGGAAAAAGATTTTATCTCTG
CCATAAGCGTTTTCCTCTAATTATCATCAGGAACGTGAGAGAAAAGTAAAAGAAGAAAAGAGATAGATTGGGACAAAGAA
GATTGAAAAACTTATGTATTTCATAGATCAAGGTTAGTTCTACTTATTTTCAAACTGTATGAGGGAATTATAGATTCTAA
TGTCCTTAGAATAAGTTATAGATTCATTGAACATAAGTGTATGGAATGTATAACTAATA





USDA Logo
Iowa State University Logo