SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr171_Gm8-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr171
Description   SOLO
Chromosome   Gm08
Start Position   36468181
End Position   36468436
Sequence   TGTTGAAACTGTGCCTACAATAGCTGCATACGTGGATGTTTTAGCTAATTTTTAAAATTTAAAATTGTTTGTTGCTTAGG
ATCTATTCTTTAGGAGTTCTGATTCTATTTTTTATCAGACTAGAAACTGTTTTAGTCATGCCTAGAAATAAAGGATTTTT
TGTTTTGTATATTTGACTCTAGCTCTATTTAAAGAGCAAATGAATAACAACTAAAATATATATACTCTTCTTTGTTTTTT
GATCTAATCTTCAACA





USDA Logo
Iowa State University Logo