SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RLC_Gmr136_Gm9-2
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr136
Description   SOLO
Chromosome   Gm09
Start Position   35879995
End Position   35880173
Sequence   TGTTGAGAATCAGGAATTTAATGTATAATGGTTTGATAGGATATGATATCGGATTTAGAGGAAACTGAATATCCTATAAT
TATGTGTAATCAATACTACCTGTCTATATCACGCTCCATAAGGTCTCTTAGACACACGGTTTCAGTCTATTATCCCTCTA
TATTTTCTCTCATTTTACA





USDA Logo
Iowa State University Logo