SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RIu_Gml3_Gm6-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LINE
Super Family   Ukn
Family   Gml3
Description  
Chromosome   Gm06
Start Position   49563947
End Position   49569848
Sequence   GCTAAATAGTTTATGGTAATTAAGATACAAAGAAAATTATGAAATTAAGCTCAAAATAAAAGGCCAGGAGAACAATTTGA
AACTGATATTAGAAGATAAAATCACTGATATTAAAATTGTTGAAAACTAATTAACCCAAAAAGCAAGAATGATGGGGAAA
GCAAGAATAAAACCTGAATACTTATTCAAGGAGGATTGAGGACCAATTGTCTCAAAAACTTGGGCTGTTTAGGGAACTTT
AGTTCAGTATCTCTGATAGGAATCTATACTTTCCTTTAATGAGTGTATGTAAATCATCCTTTAATATGATTACATTTCAT
AGTCTGAGGGTGGGGTTATTGATGTAATGCTCTATGTAATAGGTTTAAATACCTCTTGTACTCCCAATCCCATATAATAA
AATTATCTTCTTGTTCGATAATAGTAATAGACCTTTAATATGATAGACTGAGGGAAATAAATAGAACTGCTCCAACTTGT
GATCAAGCCTGTCACTATTTGAATTATTCTTACTCTTGCCCTGTCCTATGGATGGAAACTGTTCCAACTTGATGTGAATA
ATGCCTTTTTAAATGGTACTCTTGAAGAAATTGTTTTTATGATACAACCTCCTGGTTTTGAAGTTGCAAACAGGTCATTG
GTCTGCAGGCTAAATAAAGCTATCTATGGGTTAAAATAGGCTCCAAGGCAATGGTTTGACAGACTCAAGTCCACTCTGTT
ACAATTTGGGTTTGTTGGTAGCAAAAGTAATTCTTCCTTATTTATCTATCGGCATCAAGTGGATGTTGTTTATCTGCTGG
TATATGTGGATGATATAATTCTCACTGGTAGCTCAGCCACTCTGACTCAGCAGCTCACAAACAGATTGAATACTGCTTTT
TCTCTCAAACAACTTGGTCATCTGGATTATTTCTTGGGTCTGGAAATCAAATATCTGTCCAACAGTGCTATCTTAATGAC
CCAGAGTAAATACATTCGTGATTTGCTTCACAAAACTCACATGGCTAAAGCTCATTCAATCTCTTCTCCCATGGTTTCTA
ACTGCAAGTTGTCTAAACATGGTGCTGATGTTTTTCATGATCCTTCTCTCTATAGGTCTGTAGTTGGTGCATTACAATAT
GCTACTCTCACTAGACCTTAAATTAGTTTTGCTATCAATAAGGTTTTCCAATTTATGGCTGCTCCTTTGGATTCTCACTG
GACAGTGGTGAAAAGGAATCTAAGATATCTTAAAGGTACTCTGTTTCATGGTCTGCTCTTGCAGCCTACATCTACTAAAA
ATCCCTTGGCCATTCGAGCATTCTGTGATGCTGATTGGGCATCTGATGTGGATGACAGGCGCTCCACCTCAGGGACTGCC
ATTTTTCTTGGTCCAAACTTAGTCTCTTGGTGGTCTCGCAAACAAAAGGTAACTGCCAGGTCTAGTACTGAAGCTGAATA
TCGCAGCATTGCTCAAACTTCCACTTAATTGACTTGGATTTATACCCTTCTGACAGAGTTATAAGTTTCTTTCACTACTC
CAGTAATATTTTGTGATAATCAGAGTGCTGTTTCTATTGCTCACAATCCAGTTTTTCACAATCGAACAAAACACATGGGG
ATTGATGTGTTTTTTGTCAGAGAAAAGATTTTGGCCAAGCAGCTCTCAATTGTTCATATTCCAGCTCTGAATTAGTGGGC
TGAAATTCTAACTAAACCCCTGTCTGCATCAAGATTTGAGGCTCTGAGAGGCAAACTCAATGTGAAGAGTGTTTCCAATG
AAAACTCTCCTCCTTGAGTTTGAGGGGGGTATCAGTATGTCAATGTATAACTGTTTTTTTTATCAGCAAAAGAAATGTAT
ATATATTATATGATGAGTACCAGTGGTACTAGAATTACAAGGTGATATGAAATAGTCTAGTGGTTCCACTGGTCAGGCTA
TTTTCAGACTGATGTGGTCCACCCTATTCAAAATGAATACAGCAACAGGACCCCATGGCTTGTGAGACTTCCTAAATTTT
AATACCCCACAGCTAGTGAGCCCTCCTAATCTGCAGAAAAACCTATTGTTAGGTTGGTAGACCAATAGTTAAAGTGCATT
GTAAAGTCTTTCTCCGATGCTCAAAGCCAAGTCCATACCAAAAACAGTGCATCATCCATCAGCTTAGTAACGTTGAATGA
TTCATTCGAGAAAATGATCTTATTCCTATGCTGCCAAATTGTCCACGTTAGAGCTACCTACCAACACTTCCACCTATTGT
TTCGTTTCCCACCATTCATCCCGATTTGGTGCTGCAAAAAGTGGTGCCTAGGGATTATGGAGAAGGCCCCCACTATTCCT
GTCCACGATAAGGATTCCCACCATAAAGGTAGAGATTTGTTGCAGTTGAAAAATAAATGGGCTGCATCCTCCTGCAGATT
TCTGCAAAAAGGGCATATGCTGTCATTTATCTCTATTTGCCTCCTTCTCAGGTTAGACTTAGTCGGCAATCGATCTTTGA
TTAGCCTCCAAGCAAATATTGCAGCTTTGGATGGGATTTTTAGTTTCCATAGGTTCTGAAGCGCTTCATCCAGATTTGCT
CCCACTGAACATTCTTGTAGCAGGTTATATGCACTCCTAGTAGAGTAAAATCCATTAGGCTCAACTTTCCACATCCAGCA
ATCTGCTGTATGTCGCTGGATTGTAATCTGAGAGATGTCTTCCATAAAACCTACAGCGGATGCGATTTCATTATCAAACA
AAGGCCTTCTCCAAGAAAGGTTCCATTCCCATGCTGAATCATTGAAACTTCCCACCTGTTGGATGAGTTTATGTTGCTGG
AGAGATATCCGATACAGCCTTGGGTATTTCTGCTTTAGAGCTTCACCATGTCCAGACCAAGAATCCTCCTAGAATTTGAT
TTTATCCCCACACCCCACCCTCCAAGTTGTACCATCTTGGAGGATAGTATTCAGTTGTTGGTCATGTGTCACCTCCATTA
AATCTTGCCACCAAACTGACTCGTTATTCCCTCTAATACCTTCCACCATTGATCTCCATCCACCGTACTTGGAATCCAAT
ATCTTGGACCATAACCTGTTCCATTTTCCAAGTAATGCCTTGTTGAAAGCCGTTATATACCCAAACCCCCTTTTTCTTTT
GGAAGACAAACTGTTTTCCATTTCACCCATGGTATCTTTCGATGCTCCGATCTACCTCCCCATAAGAAACTACGCTGGAT
TCGGATCAGCTTATCCGTTACTTTTTCGGGCAACCTGAAAAGAGAGAAAATAGATAGGGATAGAGGATAATGTAGATTGT
ATAAGGGTCACTCTCCCCCCAAAAGATAAGTGTCTTTGTTTCCATCTAGCTAATTTTCTCTCACACTTCCTAATGACCGG
ATCCCACAGCTCGTCACGCCTTGGGTTTGCCCCAATGGGAATATCCAAATATGTTAAAGGCAATGAAAAAATCCTGCAGT
TCAAAAATTCAGCACCTTCTCTACTCCACTGGTCAGATTTACCCACTGCACCAAAATAGCTTTTTGCAAAATTTATTTTA
AGACCAGAAACTAGTTCAAATCCCCTCAATATTGTTTTGATGACCTTGACATTTTGCATGGTAGGCTCCCCAAAAAATAC
TGTATCATCAGCATATTGAAGAATGCTTACTGGTACGCTGTCTTTGCCAACCAAGAATTCAGAGAAAAGCTTCTCACTTA
TTGCTTGTCTCATTAGACCGGTTAGGCCTTCCGCTACAATGTTAAAAAGCAAAGGTGCTAACGGGTCATCCTGTCTAAGA
TCTCTATGAGGGTTAAATTCAGCAGTGGGGCTCCCGTTTACAAGTACCGAAACCGAGGCAGATTTGAGGCAACCTTGAAT
CCAGCATATCCTTTTATTGCAGAACCCCATTCTGGACATCATGTAAGTTAGAAAGTCCTAGGAGACCGCGTCGTAAGCTC
TCTCAAAATCCACTTTGAACACCAGACATGGCTTTTGCCCCCTTTTTGCTTCCTCCACCACTTCATTTGCAATGATAACA
CTATACAGCAGCTGTCTGCCATCTATGAAGGCAGATTGTCTTTCATCGATGATGGTTGGCAATACTTTCTTCAGCCTATT
TGATAGGAGCTTGGCCACAATCTTGTATATGCATCTGATAAGCGAAATAGGTATGAAATCATTGAGGGTTTGAGGGTCAG
GCACCTTAGGTAGTAAGGTGATGAAGGATGCATTGCTTCCCTTTGGGAAAATCCCAGTTGCGTGGAATTCATCAAGGAAA
CGAATTATGTCGGGCTTTAACAGCAGCCAGAATTGCTTGATAAACTTAAAATTCATTCCATCCGGGCCTGGACTTTTCTC
ACTACCGCAATCCCAAACCGCCCTCCTTATTTCTTCCTCATTAAAACTTCCCACCAGCGCCTGATTTTCCTGCTGACCAA
TGCTGTTAAAAGATATCCCATTCAGTTGTGGCCTGCACCGCATAGGCTCCTTGAATCTCTGCTGGAAAAACCTGTGAACT
TCCTCTTTCACTTTAGATGGTTCATCAACCCATGAGCCGTCAATGAACACTCCATTCACAGCATTGTATCTGCGGTTAGA
ATTGAGCAACAAGTGGAAATAACGGGAGTTGCAATCTCCCTCTTTGATCCACTTTGACCTCGCTTTCTGCCTCACTAATG
ATTTGTGTGATTTGGCTGCATCCCACAGCTTTTGTTGAAGCATTTTCCTTTTCAGATTTTCTTGGGTAGTTAATTCCCTA
TCGGCTGTTTCAGTTTCCAGCTTGCTCATCTCAGCCTCTAGGATTTGAACCTTCTTGAAAGTATCGCCAAACTGCTCCTT
ATTCCATGTCTTCAGCCTCTCTTTAAGGCGTTTGATCTTTTCTTTTAATACATAACCTCCCCACCCCCTTAATTGTGTCT
GTGACCAGCAATCATTTACTGTCCGCACAAATGACTTATCCTTAAGCCAGCAGTCAAGAATTCGGAATGGTTTGGGCCCC
CAATCCGCATTTTTGGAGCTGAATAGAACGGGGCAGTGATCGGAAAAATTCCTGTCCAGAATAAATTGTGTGCTAGTTGG
CCATTTGGTGAACCATTCAACAGATATAAATGCTCTGTCCAGCTTGCTTTTTGCGGTTCCATTTGGTCTGAACCACGAAT
ATTTTCTTCCCTCACATGGGGGTTCCTCAACTTTCATGTCTCTTAACCTATCATTAAACTCTCTGATAAGTCTGTCATCC
GCCCCTTGCTGAGATACACCCACCCTCTCTGATGGACTTCTAACACTGTTGAAATCACCCACTAGGCACCATAAGCCATT
TGGATTCATATTTTTTTGCTGCTTGAGAGATTCCCAAAGGTCTCTCTTGTTCTGAATGTCACATGGAGCATACAGATTAA
TTATGTGGACCTTTTGGGCTTCATTGGTCCATACTCCTTACAACAGGATAAACCCTCTTCCTGTTATCTTTCTTTCCACT
TTAAATCTTTTGTCACTCCATAAACATAATAAACCACCTGCTGTATTTTTTGCAGGATGCATTTCCCAGCAAACATCATC
ACCTCCCCATAGAACTTGACACGTTTTTTTGTCAATCTACTCCCTTTTCGTCTCCTGAAGACAAAGTAGATCTACTTTAT
GTTTTCTCACCAACCTCCTGATAGTGCTCCACTTGACCCCCCTCCTTAGTCCTCTTACGTTGTATGAGAGAATATTCATG
AGACCCCATTCCTGTTACCCAGCATCTCTGCCTCTTTCAAATCTCTGTCCTCCATATCACAAACTTTTGATGATGCTGTG
GTGATCCATGTCGCAGGTTACCCCCAGTTGCCTAGCCATGCTCCAGTGGTCCTCTGCCTCCTTAAGTGTCCATGTTATTG
GTTAGTAAAACTTCTGCCACCATTTGATTTTGAGGGCCACTGAACTCTTCGCATATGGATTG





USDA Logo
Iowa State University Logo