SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RIL_Gml1_Gm9-6
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LINE
Super Family   L1
Family   Gml1
Description  
Chromosome   Gm09
Start Position   32223077
End Position   32226259
Sequence   ACAACAACAACAACAACAACAACGCCTTATCCCACTAGGTGGGGTCGGCTACATGGACCAACTTCCGCCATAATGTTCTA
TCAAGTACCATACTTCTATCCAAACCATTAATTTCGAGATCCTTTTTTATAACCTCTCTTATAGTCTTTTTGGGTCTTCC
TCTGCCTCGAATTGTTTGTCTTCTCTCCATCTGGTCTACTCTCCTCACTACAGAGTCTACCGGTCTTCTCTCTACATGCC
CAAACCACCTAAGTCTATTTTCCACCATCTTCTCTACAATAGGCGCTACTCCAACCCTCTCTCTAATAGCTTCGTTTCTA
ATTTTATCCTGTCGAGTCTTACCACACATCCACCGCAACATCCTCATCTCCGCTACACCTACTTTATTCTCATGTTGGCT
CTTGACCGCCCAACATTTTGTTCCGTACAAAATCGCCGGTCTTACCGCAGTCCGATAAAACTTTCCCTTTAGCTTGATCG
GTACCTTTGCATCACATAACACCCCCGATGCTTTTCTCCATTTCATCCATCCTGCTTGAATGCGATGATTCACATCCCCT
TCAATTTCCCCATCATCCTGTATTACAGACCCAAGATATTTAAACCGTGTGACTTGAGGGATAATATGGTCTCCTATTTT
CACCTCTGAGTTAGAAACCCTCCTTCTTTTGTTGAACTTACATTCCATATACTCCGATTTGCTTCTGCTTAGGCGAAAGC
CATGTGTTTCTAGAGCTCGTCTCCAAGTTTCCAACCTCTCATTCAACTCCTCCCTCGACTCTCCAAGGAGGACTATGTCA
TCTGCAAAAAGCATGCATCTCGGCGCTATCTCTTGAATTTGTTCCGTGAGGACATCCAGAATTAAGGTAAAAAGGTAGGG
GCTAAGGGTTGACCCTTGATGTAAACCAATTGTGATGGGAAAATCGTCTGACTCTCCACCCTGTGTCCTAACACTAGTCG
ATACCCTATCATACATATCTTGGATAGCTCGAATATATGCAACCCTAACCCCTTTCTTCTCTAGAGCTTTCCACAAAATC
TCTCTAGGCACTCTATCATACGCTTTCTCCAAGTCAATAAAAATCAAGTGCAAGTCTTGTTGGGCCAGTCGATATTGCTC
CATCACCCGCCGTAATAAGTAAATCGCTTCCATGGTCGACCTTCCCGGCATGAAACCAAATTGATTCTCAGTAACTTGAG
TCTCCTTTCTTAATCTCCGTTCGATCACTCTTTCCCATAATTTCATGGTATGACTCATGAGCTTGATTCCCTTATAATTT
GCACAATTTTGTATATCCCCCTTGTTCTTATAGATTGGCACTAACGTGCTTCTCCTCCATTCCTCCGGCATGCGTTTTGA
CCTCAAAATTTCGTTAAAGAGTTCGGTGAGCCACTCAAGACCTCTATCTCCAAGAGTTTTCCACACTTCAATAGGTATGT
TGTCTGGCCCCACCGCCTTACCATTACTCATTCTTTTCAACGCTTCCTTTACTTCCTGTTTCTGAATCCGACGATAGTAC
TTATAGTTCCGGTCCTCTTCTCTTGTGTCTAGACTGCTAGAGTCATATCCATATCCATCATTAAATAAGTCGTGGAAATA
CACCTTCCACCTTTCCTTGATATCTTTTTCATGCACTAAGACTTTGCCTTTTTCATCCTTAACACACTTTACTTGATCCA
AATCTCTAGTCTTCCTCTCTCTACCCTTAGCAAGCCTATATATAGATCTTTCTCCGTCCTTGGTTCCTAGAGCTTGGTAT
AGTCCGTCAAAAGCTTGGGCTCTTGCCTCACTCACCGCCTTTTTGGTTTCATTTCTAGCTATCTTATACTTATCCCAAGT
TTCAGAATTTCTACACCTAGACCACTCCTTGAAACACTCCTTTTTTACTCTAACTTTGCTCTGAACATTTTCATTCCACC
ACCACGATTCTTTACCCCTAGGTCCAAAACCTCTAGATTCACCCAACGTCTCTTTAGCCACTTTAATAATCTCTTGGGAC
ATCTTGTTCCACATATCATTTGCACTTCCTTGTGATTGTCCCCACCAACCCTCCCATATCTTTTGTTGGAAGATTCCTTG
TTTCTCACCCTTCAAGTGCCACCATTTGATCCTTGGTGCTACCAGAGGACTTCTTCTCTTTGCCCTATCTCTAATTCTTA
CATCCATAACCAAAACTCTATGTTGGGTAGTCAAGCTCTCTCCCGGGATAACTTTACAGTTCAAGCAATACTTCCTATCA
GACTTCCTGATAAGGAAGAAATCTATCTGAGAACATGTCCCTCCACTTTTGTAAGTGATAAGATGTTCCTCTCTTTTCTT
AAACCATGTATTGGCTATAGAAAGATCCAAAGCCTCCGAAAACTCCAAGATGGATTTACCCTCCCCATTCATCTCCCCTA
GGCCAAAACCCCCATGCACCCCCTCAAAACCTCTAGCCACGCTACCTACATGTCCATTGAGATCCCCTCCTAGGAAAACT
TTCTCTCCTTGGGGTATATCCTGAAGTACCCCTTCTAGATCCTCCCAAAATTTTACCTTAAAGTGTTCTGCTAACCCAAC
CTGAGGTGCGTACCCACTAATAACATTAAAGGTGTCCTGTCCCACTACCAATTTTAAGACTATGATACGATCTCCTACTC
TTCTTACATCCACGACATCCTTCTTCCACTCCTTGTCCACAATAATCCCTACCCCATTTCTTGATCTGATTTTTCCCGTA
TACCACAGCTTAAATCCCGAGTTGTCTAATTCTTTCGCTTTTTCACCTGTCCACTTAGTTTCTTGTAGGCACATAAAATT
GATCTTCCTCCTCACCATAACATCCACTATTTCCATAGATTTTCCAGTAAGTGTGCCTATATTCCATGTACCAAAGCGAA
TCCTCCTATCATGAACTAGCTTCTTTACCCACACCCGTTCACGAAAATGTGGGAACCCTTGCTTACTTTTCACTACATCC
GGGCGGCGATGCAGCGGCCCTTGCTCTTTTGACACTGTACTCGAGCCATACAGCGCGTTGCTTCCGGGCAACGACCTAGC
ATTCACATTATTACGTAATTGATCCATGTCATAGAGATTCGACAAAGTTTAACGTTGGCTGTCGAAAGCCTAACACAACC
CTCTCCTTTTATCCGGGCTTGGGACCGGCTAAGAATAGCAAAGCTACCCTAGGCAGGATTATA





USDA Logo
Iowa State University Logo