SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt540
Map NamePosition
GmComposite2003_M 35.84
GmConsensus40_M 34.267


Genomic Sequence Information for Satt540
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm07 49629874963031(TTA)15Wm82yesGlyma 1.0
Gm07 50106965010849(TTA)15Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt540
mqPlant height-012
Reproductive stage length 5-4
Seed genistein 11-9
Seed genistein 13-2
Seed genistein 2-3
Seed genistein 3-4
Seed glycitein 11-7
Seed glycitein 13-1
Seed glycitein 2-7
Seed glycitein 3-2
Seed isoflavone 1-7
Seed isoflavone 11-4
Seed isoflavone 2-5
Seed oil 23-6
Seed oil 42-22
Seed protein 24-4
Seed total isoflavone 9-9
Seed weight 45-4
Seed yield 31-11
Seed yield to weight ratio 1-1


Amplification Info for Satt540
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt540
Primer1CTGGCGAATCAAGCTTTGTAAC
Primer2CCGTGATTGCGAAGAGGATATT
Motif(TTA)15
    
NameBARCSOYSSR_07_0263
Primer1CTGGCGAATCAAGCTTTGTAAC
Primer2CCGTGATTGCGAAGAGGATATT
Motif(TTA)15
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt540
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo