SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt197
Map NamePosition
GmComposite2003_B1 46.38
GmConsensus40_B1 49.069


Genomic Sequence Information for Satt197
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm11 88794808879539(ATT)20Wm82yesGlyma 1.0
Gm11 88988788899050(ATT)20Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt197
Branching 1-3
Canopy wilt 4-7
Chlorosis, leaflet UV-B induced 1-2
First flower 11-1
Flower number 1-5
Leaflet length 6-1
Leaflet length 7-2
Node number 3-5
Node number 3-6
Nodule weight per plant, dry 1-3
Plant height 20-1
Plant height 24-5
Plant height 24-6
Plant height 26-7
Plant height 26-8
Pod maturity 17-1
Pod maturity 17-2
Pod number 1-5
Pod wall width 1-6
Sclero 3-3
Seed coat cracking 3-6
Seed glycitein 4-2
Seed glycitein 8-7
Seed linoleic 7-2
Seed oil 24-11
Seed oleic 7-2
Seed protein 25-1
Seed protein 36-2
Seed set 5-25
Seed sucrose 2-1
Seed weight 25-2
Seed yield 22-1
Shoot weight, dry 5-1


Amplification Info for Satt197
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt197
Primer1CACTGCTTTTTCCCCTCTCT
Primer2AAGATACCCCCAACATTATTTGTAA
Motif(ATT)20
    
NameBARCSOYSSR_11_0482
Primer1CACTGCTTTTTCCCCTCTCT
Primer2AAGATACCCCCAACATTATTTGTAA
Motif(ATT)20
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt197
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo