SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Sat_286
Map NamePosition
GmComposite2003_L 87.41
GmConsensus40_L 77.467


Genomic Sequence Information for Sat_286
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm19 4497889244978955(AT)32Wm82yesGlyma 1.0
Gm19 4518245845182612(AT)32Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Sat_286
Branching 3-2
First flower 24-3
Pod number 8-1
SCN 29-7
SCN 45-5
Seed daidzein 7-6
Seed genistein 7-7
Seed isoflavone 6-5
Seed number 5-1
Seed number 6-1
Seed oil 43-26
Seed oil 43-28
Seed protein 36-31
Seed protein 36-32
Seed weight 42-4
Seed weight 43-4
Seed weight per plant 4-1
Seed weight per plant 5-2
Stem length, main 2-3
Stem length, main 3-2
Stem weight, dry 1-1
Stem weight, dry 2-2


Amplification Info for Sat_286
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSat_286
Primer1GCGTTGCTTGCTAAGTAGTGTTTTTAATCCT
Primer2GCGTCTCCCATCATGCAACTTCAATA
Motif(AT)32
    
NameBARCSOYSSR_19_1329
Primer1GCGTTGCTTGCTAAGTAGTGTTTTTAATCCT
Primer2GCGTCTCCCATCATGCAACTTCAATA
Motif(AT)32
    

References for Sat_286
Song et al. 2004 A new integrated genetic linkage map of the soybean Theor Appl Genet 2004 109:122-128






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo