Report for Sequence Feature Glyma18g43900
Feature Type: gene_model
Chromosome: Gm18
Start: 53530321
stop: 53531366
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma18g43900
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G55210 AT
Annotation by Michelle Graham. TAIR10: Disease resistance-responsive (dirigent-like protein) family protein | chr1:20598057-20598620 REVERSE LENGTH=187
SoyBase E_val: 7.00E-68 ISS
GO:0006952 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response
SoyBase N/A ISS
GO:0009627 GO-bp
Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance
SoyBase N/A ISS
GO:0009807 GO-bp
Annotation by Michelle Graham. GO Biological Process: lignan biosynthetic process
SoyBase N/A ISS
GO:0034976 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress
SoyBase N/A ISS
GO:0005576 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: extracellular region
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
PTHR21495 Panther
NUCLEOPORIN-RELATED
JGI ISS
PF03018 PFAM
Dirigent-like protein
JGI ISS
UniRef100_C6SWG8 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SWG8_SOYBN
SoyBase E_val: 2.00E-139 ISS
UniRef100_G7KU38 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Disease resistance response protein n=1 Tax=Medicago truncatula RepID=G7KU38_MEDTR
SoyBase E_val: 4.00E-88 ISS
Expression Patterns of Glyma18g43900
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma18g43900
Paralog Evidence Comments
Glyma07g19360 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma18g43900 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.18g207700 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma18g43900
Coding sequences of Glyma18g43900
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma18g43900.1 sequence type=CDS gene model=Glyma18g43900 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGTTCATCCAATTCCTCATCTTTTCCCTCCTCTTCACTCCCTTCACGATCATCTCCACCATAGCCCATGACACCGATGATTTTGTGCGCACATTAGACCGCAAAATGTTGGGTTTGGACGAAAAGAAAGAAAAGTTCATCCATTTCAGGTTCTACTGGCATGACGCGATGAGTGGACGCAACCCTTCTTCAGTTGAAGTTGTGCCACCACCTTTGAAGAACTCAACCACGCGCTTTGGATTGGTGAACATGCTCGATAACCCTTTGACTTTGGGACCTCAATTGAACTCCAAGTTGGTGGGGCAAGCACAAGGGTTCTATGCTTCTACGTCACAAAGTGAGTTTGTTTTGCTCATGGCTATGAATCTTGTCATCACCGAAGGAAAGTACAATGGCAGCACCATCACTATTTTGGGGAGAAACCCTATTTACTATGAGGAGAGGGAGATGCCCGTGATTGGTGGAAGTGGCCTCTTTCGATTTGCTAGGGGATATGCTAAACTTAGAACTTACTGGTTCTCACCCTCCACCAGAGATGCCATTGTTGAGTACAATGTCTATGTTTTGCATTATTATTGA
Predicted protein sequences of Glyma18g43900
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma18g43900.1 sequence type=predicted peptide gene model=Glyma18g43900 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MFIQFLIFSLLFTPFTIISTIAHDTDDFVRTLDRKMLGLDEKKEKFIHFRFYWHDAMSGRNPSSVEVVPPPLKNSTTRFGLVNMLDNPLTLGPQLNSKLVGQAQGFYASTSQSEFVLLMAMNLVITEGKYNGSTITILGRNPIYYEEREMPVIGGSGLFRFARGYAKLRTYWFSPSTRDAIVEYNVYVLHYY*
SoyBase
Follow us on Twitter @SoyBaseDatabase
