Glyma14g09340 - SoyBase

SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g09340

Feature Type:	gene_model
Chromosome:	Gm14
Start:	7380913
stop:	7383057
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g09340

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G52010	AT	Annotation by Michelle Graham. TAIR10: C2H2-like zinc finger protein \| chr5:21121626-21122816 REVERSE LENGTH=396	SoyBase	E_val: 9.00E-157	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0003676	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
UniRef100_I1M8P5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M8P5_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q9FJ91	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: AT5g52010/MSG15_9 n=2 Tax=Arabidopsis thaliana RepID=Q9FJ91_ARATH	SoyBase	E_val: 4.00E-154	ISS

Expression Patterns of Glyma14g09340

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma14g09340

Paralog	Evidence	Comments
Glyma17g35830	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma14g09340 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g084900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g09340

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g09340

Limit To All Plant Sequences

>Glyma14g09340.1   sequence type=CDS   gene model=Glyma14g09340   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGAGGAAAACAGGTTCCTTGGATTTTCTGGCACCTCAACTCCCCTTATCTTTCTATCCATCGTCAGGCGATGCGATGAACAATTCCCTGTTTCTCCTTCACAATGCAAATGCAATCATCCACTTCAATTTTCATTCCCACCCTACCCTTCCTTCCATTCCCCGAACCACAAAACCCTTCCCTCACCGTCACTACCCACGCATCCAATGCTGCAGCAGCAACATCCAAATCGACATGGTGAAGAACAGCCAAGGAATCTATGCCCCCAAAAACGACAAGGTCGTCGTCCTCTGGGACCTCGACAACAAGCCCCCCCGCGGCGCTCCCTACGACGCCGCCGTCTCCCTCAAAACCCTCGCCGCCCGCTTCGGCCACCTCGTTGACTTCTCCGCCTACGCCAACCGCCACGCCTTCGTCCACCTCCCCCAGTGGGTCCTCCACCAGCGCCGCCACCGCAGAAACCTCGACATCCTCGAACGCAAGGGCGTCATCACCCCACCCGAGCCCTACACGTGCGGCGTGTGCGGCCGCAAGTGCAAGACCCACCTAGACCTCAAGAAACACTTCAAGCAGCTCCACCAGCGCGAGCGCCAGAAGAAGCTCAACCGTCTCAAATCCCTAAAGGGGAAAAAACGGCACCGTTTTAAGGAGCGGTTTTTGCGCGGGAATCACAAGTATGACGATGCTGCGAGAACGCTGGTGGTGCCGAAGGTCGGGTACGGGCTGGCGGCGGAGCTGCGGCGGGCGGGGGTGTTTGTGAAGACGGTGCAGGACAAGCCTCAGGCGGCGGATTGGGCCTTGAAGAGGCAAATGGTTCACTCCATGAGCAGAGGTATTGATTGGCTGTTTTTGGTTTCGGATGATTCGGATTTTTCGGAGATGCTGAGGAGGGCTAGGGAGGCTGATTTGGGAACCGTGGTGGTCGGGGATTGGGATAAGGCGCTTGGGCGCCACGCCGATTTGTGGGTGCCGTGGAGTGGAGTGGAGAATGGGGAGGTGGGGGATTTGTTGCCCAAGAGAAGAAGGGAGAATAGTAGAAGAAGAGAACAGGGGGAAGAACATGGTTTTGGTTTGGAAGATGATGACGGTGGGGTGTTTTTGAATGAGGATGAGGAATTGGGGCAAGAGTTTATGTTGTTGTATAGTGAGGACGAGGATGAGGACGTGGATGTGGAGGACTATTATGATGACGATGATGATGATGAAGAAGAGGAAGATGGGTTTTATATTCTTTGA

Predicted protein sequences of Glyma14g09340

Limit To All Plant Sequences

>Glyma14g09340.1   sequence type=predicted peptide   gene model=Glyma14g09340   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKRKTGSLDFLAPQLPLSFYPSSGDAMNNSLFLLHNANAIIHFNFHSHPTLPSIPRTTKPFPHRHYPRIQCCSSNIQIDMVKNSQGIYAPKNDKVVVLWDLDNKPPRGAPYDAAVSLKTLAARFGHLVDFSAYANRHAFVHLPQWVLHQRRHRRNLDILERKGVITPPEPYTCGVCGRKCKTHLDLKKHFKQLHQRERQKKLNRLKSLKGKKRHRFKERFLRGNHKYDDAARTLVVPKVGYGLAAELRRAGVFVKTVQDKPQAADWALKRQMVHSMSRGIDWLFLVSDDSDFSEMLRRAREADLGTVVVGDWDKALGRHADLWVPWSGVENGEVGDLLPKRRRENSRRREQGEEHGFGLEDDDGGVFLNEDEELGQEFMLLYSEDEDEDVDVEDYYDDDDDDEEEEDGFYIL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain