Glyma11g02140 - SoyBase

SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma11g02140

Feature Type:	gene_model
Chromosome:	Gm11
Start:	1322676
stop:	1324457
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma11g02140

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G23750	AT	Annotation by Michelle Graham. TAIR10: cytokinin response factor 2 \| chr4:12376751-12377782 FORWARD LENGTH=343	SoyBase	E_val: 8.00E-51	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006606	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein import into nucleus	SoyBase	N/A	ISS
GO:0042991	GO-bp	Annotation by Michelle Graham. GO Biological Process: transcription factor import into nucleus	SoyBase	N/A	ISS
GO:0048364	GO-bp	Annotation by Michelle Graham. GO Biological Process: root development	SoyBase	N/A	ISS
GO:0048825	GO-bp	Annotation by Michelle Graham. GO Biological Process: cotyledon development	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0042802	GO-mf	Annotation by Michelle Graham. GO Molecular Function: identical protein binding	SoyBase	N/A	ISS
PF00847	PFAM	AP2 domain	JGI		ISS
UniRef100_G7KAN6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Ethylene-responsive transcription factor RAP2-6 n=1 Tax=Medicago truncatula RepID=G7KAN6_MEDTR	SoyBase	E_val: 2.00E-71	ISS
UniRef100_I1LGA6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LGA6_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma11g02140

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma11g02140

Paralog	Evidence	Comments
Glyma01g43350	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma11g02140 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.11g019000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma11g02140

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma11g02140

Limit To All Plant Sequences

>Glyma11g02140.1   sequence type=CDS   gene model=Glyma11g02140   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACTGCGCCACCGACGAAGTACACTCACCACACCAAACTACTCATACCCCCCGAAGAAGACCCACCCAAACACCATTATCCCAGACTCGTCAGAATAACCGTCACTGACACCGACGCCACCGACTCCTCCAGCGACGAAGAAGAAGAACAAACATACCACTGCAACTCTTCCACGCGCCACCGACATAGGAAGTTCGTCAATGAGATTTCTATCGAGTCGTGCTCCAGCGAGAACGACGGCGTCGTTTCGAGGAAGCGAATTCGAAGAAGAAGCACCACTACGCCCAAAGCGACAAGAGCTTCAGACACTCGGCGCGTGTCCGACGGTAAGAAATTCCGCGGAGTGAGACAGAGGCCGTGGGGAAAATGGGCCGCGGAGATACGAGACCCAGCGCGACGCGTTCGGTTATGGTTGGGTACCTACGACACTGCTGAGGAAGCCGCTTTGGTGTACGACAACGCCGCCATTAAGCTGCGTGGACCCCACGCGCTCACCAATTTCATAACGCCACCTTCCGGGGAGGAAACTCATTGCAATAGCAAGAATATCTTTTCTCCCACTTCCGTGCTTCACTGTTGCTCCTTGTCCGAGGAAGCTGAGTCCGTTACGGCCAAAGACGATGACTACTCCTCGGTGTCGGAGAATAAGGTCAAAGCTGAGTCAGCGTTTCCGCCCGAAATAGATTTTGAGTTTCGAGCTTGTTCGACTGTGCCGGAGAGTCTGTTGTTCTGCGATGATGATTGGTCTAGTGAGTTTCTCAATTCTTATGAAGATTTCGGTTTCAAAAGTTGGCATACGGACAGAAATCGTGACTTTTTCCAAGATATCGACGATTTGTTTGTCTCGGATCCCCTCCTTGCTCTCTGA

Predicted protein sequences of Glyma11g02140

Limit To All Plant Sequences

>Glyma11g02140.1   sequence type=predicted peptide   gene model=Glyma11g02140   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTAPPTKYTHHTKLLIPPEEDPPKHHYPRLVRITVTDTDATDSSSDEEEEQTYHCNSSTRHRHRKFVNEISIESCSSENDGVVSRKRIRRRSTTTPKATRASDTRRVSDGKKFRGVRQRPWGKWAAEIRDPARRVRLWLGTYDTAEEAALVYDNAAIKLRGPHALTNFITPPSGEETHCNSKNIFSPTSVLHCCSLSEEAESVTAKDDDYSSVSENKVKAESAFPPEIDFEFRACSTVPESLLFCDDDWSSEFLNSYEDFGFKSWHTDRNRDFFQDIDDLFVSDPLLAL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain