SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g36400

Feature Type:gene_model
Chromosome:Gm05
Start:40229306
stop:40232932
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g36400
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G10670AT Annotation by Michelle Graham. TAIR10: non-intrinsic ABC protein 7 | chr3:3335325-3337304 REVERSE LENGTH=338 SoyBaseE_val: 1.00E-127ISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006569GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process SoyBaseN/AISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0009073GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family biosynthetic process SoyBaseN/AISS
GO:0009684GO-bp Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009902GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast relocation SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0034660GO-bp Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042793GO-bp Annotation by Michelle Graham. GO Biological Process: transcription from plastid promoter SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016887GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity SoyBaseN/AISS
GO:0017111GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity SoyBaseN/AISS
GO:0042626GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity, coupled to transmembrane movement of substances SoyBaseN/AISS
PTHR24220Panther FAMILY NOT NAMED JGI ISS
PTHR24220:SF6Panther SUBFAMILY NOT NAMED JGI ISS
PF00005PFAM ABC transporter JGI ISS
UniRef100_G7LIW2UniRef Annotation by Michelle Graham. Most informative UniRef hit: ABC transporter I family member n=1 Tax=Medicago truncatula RepID=G7LIW2_MEDTR SoyBaseE_val: 1.00E-159ISS
UniRef100_I1K648UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K648_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma05g36400
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g36400
ParalogEvidenceComments
Glyma08g03180 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g36400 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g221600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g36400
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g36400
>Glyma05g36400.1   sequence type=CDS   gene model=Glyma05g36400   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGTTATCCCTTCCCACCCACCCTTCTCCCACCGTTAATCCTCTCCGACGATCCCCAAAACCCACCCTCCGCCGCGTCAACCACCGCGTTTGCGTGGCCAGCGCCGCCACTCCCCTCCTCCAAGTCAATGACTTGAGGGCCAAGATTGTCGAATCCAACGTTGACATTCTCCACGGCGTTAACCTCACCATCAACCAAGGAGAGGTCCACGCCATCATGGGGAAAAACGGTTCCGGCAAAAGCACTTTCGCCAAGGTTCTTGTGGGGCACCCAGATTATGAAGTAACCGGAGGCAGTGTTGTTTTCAAGGGGGAGAATTTGCTTGAGATGGAACCTGAAGAAAGGTCTCTTGCGGGTCTCTTCATGAGTTTTCAATCCCCTGTTGAAATCCCCGGTGTTTCCATTGATCTGTTTCTCGCCATGGCCTACAATGCTCGAATGAAAAAACTTGGTCGAGATGAGGTTGGACCAATCGAGTTTTTACCTTACCTGATGGAGAAGCTTCAGCTTGTTAACATGAAGCCTGACTTTCTCAATAGGAATGTGAACCAAGGGTTTAGTGGCGGTGAACGCAAGCGCAATGAAATCTTGCAGCTTGCGGTTTTGGGGGCGGACTTGGCTATTTTGGATGAAATTGATTCTGGTTTGGATGTTGATGCGCTCAGGGATGTTGCGAATGCAGTTAATAGGATTCTCACCCCAGAAAAGTCCTTGTTGATGATAACTCATTATAGACGGATTCTGGATCTTTTGAATCCTACACATGTCCATGTTATGGACAAAGGGAAAATTGCAAGGACAGGCGACATATCAGTGGTAGAAGCTATTGAGTCAGATGGATATGAAGCAGTCTCTGCTTTAACATAA
Predicted protein sequences of Glyma05g36400
>Glyma05g36400.1   sequence type=predicted peptide   gene model=Glyma05g36400   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALSLPTHPSPTVNPLRRSPKPTLRRVNHRVCVASAATPLLQVNDLRAKIVESNVDILHGVNLTINQGEVHAIMGKNGSGKSTFAKVLVGHPDYEVTGGSVVFKGENLLEMEPEERSLAGLFMSFQSPVEIPGVSIDLFLAMAYNARMKKLGRDEVGPIEFLPYLMEKLQLVNMKPDFLNRNVNQGFSGGERKRNEILQLAVLGADLAILDEIDSGLDVDALRDVANAVNRILTPEKSLLMITHYRRILDLLNPTHVHVMDKGKIARTGDISVVEAIESDGYEAVSALT*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo