Glyma05g09390 - SoyBase

SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g09390

Feature Type:	gene_model
Chromosome:	Gm05
Start:	9096700
stop:	9097908
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma05g09390

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G08410	AT	Annotation by Michelle Graham. TAIR10: ferredoxin/thioredoxin reductase subunit A (variable subunit) 2 \| chr5:2709974-2710528 REVERSE LENGTH=184	SoyBase	E_val: 1.00E-33	ISS
GO:0009107	GO-bp	Annotation by Michelle Graham. GO Biological Process: lipoate biosynthetic process	SoyBase	N/A	ISS
GO:0009965	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis	SoyBase	N/A	ISS
GO:0015979	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosynthesis	SoyBase	N/A	ISS
GO:0019684	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction	SoyBase	N/A	ISS
GO:0030154	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell differentiation	SoyBase	N/A	ISS
GO:0045893	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009536	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plastid	SoyBase	N/A	ISS
GO:0008937	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ferredoxin-NAD(P) reductase activity	SoyBase	N/A	ISS
GO:0016992	GO-mf	Annotation by Michelle Graham. GO Molecular Function: lipoate synthase activity	SoyBase	N/A	ISS
GO:0030385	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ferredoxin:thioredoxin reductase activity	SoyBase	N/A	ISS
GO:0051539	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 4 iron, 4 sulfur cluster binding	SoyBase	N/A	ISS
PTHR10949	Panther	LIPOIC ACID SYNTHETASE	JGI		ISS
PTHR10949:SF1	Panther	LIPOIC ACID SYNTHETASE	JGI		ISS
PF02941	PFAM	Ferredoxin thioredoxin reductase variable alpha chain	JGI		ISS
UniRef100_B9RGK8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Lipoic acid synthetase, putative n=1 Tax=Ricinus communis RepID=B9RGK8_RICCO	SoyBase	E_val: 3.00E-39	ISS
UniRef100_I1K1Q3	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K1Q3_SOYBN	SoyBase	E_val: 9.00E-103	ISS

Expression Patterns of Glyma05g09390

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma05g09390 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.05g000300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma05g09390

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma05g09390

Limit To All Plant Sequences

>Glyma05g09390.1   sequence type=CDS   gene model=Glyma05g09390   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGCGGCGCCAGCAGCACTATAAGGCTATCGCCGATGGTGAGCGTGTCCCCGAATTGCAATTGCTCATCGATGATGGTGATGAAGAAGACGACGACGGCGGTGGCTCCTTTGTGGATGAAAAGCAAGAGCGCTAGGGGTGGTATTAGGTGCGAGGTGGCTATTAATGCGGTGGATGAGTCGACGACGTCACCGGAGTCGAAGATTGGAGCGCGTGTGAAGGTGAAGGCGGGTGTAAAGGTGTACCACGTCCCCAAAGTAGCCGAGCTTGACCTCACGGGTCTGGAAGGCGAGATCAAGCAGTATGTTGGCCTCTGGAACGGTAAGCGAATCTCCGCCAATCTTCCTTACAAGGTTCAGTTTCTCACCGACATCCCAGCTCGTGGTCCTGTCAAGTTTTTTGCCCACCTCAAGGAAGATGAATTCGACTATCTTTAG

Predicted protein sequences of Glyma05g09390

Limit To All Plant Sequences

>Glyma05g09390.1   sequence type=predicted peptide   gene model=Glyma05g09390   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSGASSTIRLSPMVSVSPNCNCSSMMVMKKTTTAVAPLWMKSKSARGGIRCEVAINAVDESTTSPESKIGARVKVKAGVKVYHVPKVAELDLTGLEGEIKQYVGLWNGKRISANLPYKVQFLTDIPARGPVKFFAHLKEDEFDYL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain