Glyma04g40090 - SoyBase

SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g40090

Feature Type:	gene_model
Chromosome:	Gm04
Start:	46218113
stop:	46227122
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g40090

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G40660	AT	Annotation by Michelle Graham. TAIR10: Nucleic acid-binding, OB-fold-like protein \| chr2:16966011-16968866 FORWARD LENGTH=389	SoyBase	E_val: 2.00E-142	ISS
GO:0000085	GO-bp	Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle	SoyBase	N/A	ISS
GO:0006418	GO-bp	Annotation by Michelle Graham. GO Biological Process: tRNA aminoacylation for protein translation	SoyBase	N/A	ISS
GO:0009220	GO-bp	Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0009640	GO-bp	Annotation by Michelle Graham. GO Biological Process: photomorphogenesis	SoyBase	N/A	ISS
GO:0009909	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of flower development	SoyBase	N/A	ISS
GO:0034968	GO-bp	Annotation by Michelle Graham. GO Biological Process: histone lysine methylation	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0000049	GO-mf	Annotation by Michelle Graham. GO Molecular Function: tRNA binding	SoyBase	N/A	ISS
KOG2241	KOG	tRNA-binding protein	JGI		ISS
PTHR11946	Panther	ISOLEUCYL, LEUCYL, TYROSYL, VALYL AND METHIONYL-TRNA SYNTHETASES	JGI		ISS
PTHR11946:SF22	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF01588	PFAM	Putative tRNA binding domain	JGI		ISS
UniRef100_B9S4F8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Methionyl-tRNA synthetase, putative n=1 Tax=Ricinus communis RepID=B9S4F8_RICCO	SoyBase	E_val: 9.00E-173	ISS
UniRef100_C6T9H6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T9H6_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma04g40090

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g40090

Paralog	Evidence	Comments
Glyma06g14760	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g40090 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g222900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g40090

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g40090

Limit To All Plant Sequences

>Glyma04g40090.1   sequence type=CDS   gene model=Glyma04g40090   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTACCATTGAAAGTAGAAGGAAATCAGTGGCTTTGGCTCTCTCCAAGTACTTTTCATTGGATCCTAGTGTTGTTCCAGCCGATAGTTCAGACAGTGATATTAAGAGTCTTTACTTGAACATCATAGCGGTTTCTGGACATAGGGTTAATCACTCTGATGAGGTGTTGAAGTGGGTAGCATTTGCAGAAGCCTTCCCCGTGGCCCTTGATGCATGCTTTGAGAATCTCAAGAGATTAAATGATGAACTGTCTGGAAAGGCTGTGCTTCTGGGCAATGGATTGAACCCCTCTGAAGCTGATGTTATAGTGTATTCAGTGGTTCATTCTTCCCTGATCAACCTTTCAGATACAAGCAAGGAGAAACTGCCACATGTCTTGAGATGGATGGATTACATCCAGCACAAGCAAGAATTTGTAGGTTTATTTGAGAAAATATTGTTGAAGAAGCCTGAATTTGAGCCTCTGGTAACAAAACCTGTTGGTGCTGTGGAAGCTGATTTAAAATCAAACAAGACTGAGCAAAGTATAAAGAATGTCAACAAGTCCGAAGCAGATTCAAGCAAGGATAAAAACAAAGCTGAGGGAAAGGCAACAGGAGGAAAATCAACTGGAGACAAAGAACCTACCAAAGGCAAGGCAAAACCTGCTGACAAAGTGGCTGAGAAAGAGAATGAAGTTAGCGTCAGTTTGCTTAATATTCAAGTTGGATTAATTCACAAAGCGTGGAAGCATCCATCTGCAGATAGTTTGCTAGTTGAGGAGATAGATGTTGGGGAGGCCAAAGTGCGGCAGGTTGTTAGTGGTTTGGCAAAGTACTACAGTCCTGATGAGTTGATGAATCGTCGTGTTGTACTTATAACAAATGTCAAACCTGGAAAACTACGGGATGTGATGTCTGAAGGACTGGTCTTATGTGCTTCGAATGAAGGTCCAACCATTGTGGAGCCCTTGCTCCCTCCAGAAGGAGCAAAAATTGGTGAACATATTTCTTTTTCTGGGATTGATGGAAAGCCAGAAGATGTACTAAACCCAAAAAAGAAACAGCTGGAGAAGATTACACCGCATCTTTTCACTGATGACAAGGGGGTGGCCACATACAAGGGAATACCATTTATGACGTCTGGTGGACCATGCACATCATCCATTCCCAGAGCAACTATTAGATAA

Predicted protein sequences of Glyma04g40090

Limit To All Plant Sequences

>Glyma04g40090.1   sequence type=predicted peptide   gene model=Glyma04g40090   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATIESRRKSVALALSKYFSLDPSVVPADSSDSDIKSLYLNIIAVSGHRVNHSDEVLKWVAFAEAFPVALDACFENLKRLNDELSGKAVLLGNGLNPSEADVIVYSVVHSSLINLSDTSKEKLPHVLRWMDYIQHKQEFVGLFEKILLKKPEFEPLVTKPVGAVEADLKSNKTEQSIKNVNKSEADSSKDKNKAEGKATGGKSTGDKEPTKGKAKPADKVAEKENEVSVSLLNIQVGLIHKAWKHPSADSLLVEEIDVGEAKVRQVVSGLAKYYSPDELMNRRVVLITNVKPGKLRDVMSEGLVLCASNEGPTIVEPLLPPEGAKIGEHISFSGIDGKPEDVLNPKKKQLEKITPHLFTDDKGVATYKGIPFMTSGGPCTSSIPRATIR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain